EMAIL THIS PAGE TO A FRIEND

TMEM80

transmembrane protein 80

UniProtKB ID: Q96HE8, A8MQ01, A8MXY8, B7WNU5
Gene ID:
Mouse(71448) transmembrane protein 80
Rat(309109) transmembrane protein 80
cow(613612) transmembrane protein 80
sheep(101102855) transmembrane protein 80
domestic guinea pig(100733071) transmembrane protein 80
naked mole-rat(101708091) transmembrane protein 80
chicken(769979) transmembrane protein 80
domestic cat(101099501) transmembrane protein 80
dog(483410) transmembrane protein 80
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042463 Rosetta Predictions human pricing
NM_174940 Rosetta Predictions human pricing
NM_001017455 Rosetta Predictions rat pricing
NM_027797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309918 predicted 1060
2 SASI_Hs02_00309919 predicted 1053
3 SASI_Hs02_00309920 predicted 865
4 SASI_Hs02_00309921 predicted 866
5 SASI_Hs02_00309922 predicted 1074
6 SASI_Hs02_00309923 predicted 765
7 SASI_Hs02_00309924 predicted 376
8 SASI_Hs02_00309925 predicted 367
9 SASI_Hs02_00309926 predicted 1054
10 SASI_Hs02_00309927 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046865 predicted 1033
2 SASI_Hs01_00046867 predicted 1030
3 SASI_Hs01_00046868 predicted 842
4 SASI_Hs01_00046869 predicted 846
5 SASI_Hs02_00368880 predicted 1048
6 SASI_Hs01_00046874 predicted 744
7 SASI_Hs01_00046871 predicted 351
8 SASI_Hs01_00046872 predicted 495
9 SASI_Hs02_00368881 predicted 341
10 SASI_Hs02_00368882 predicted 1030
11 SASI_Hs01_00046866 predicted 821
12 SASI_Hs01_00046870 predicted 333
13 SASI_Hs01_00046873 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115492 predicted 753
2 SASI_Rn01_00115494 predicted 466
3 SASI_Rn01_00115495 predicted 546
4 SASI_Rn01_00115496 predicted 837
5 SASI_Rn01_00115497 predicted 1088
6 SASI_Rn01_00115498 predicted 463
7 SASI_Rn02_00202250 predicted 500
8 SASI_Rn01_00115499 predicted 1148
9 SASI_Rn01_00115500 predicted 862
10 SASI_Rn01_00115501 predicted 955
11 SASI_Rn01_00115493 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151891 predicted 402
2 SASI_Mm01_00151892 predicted 540
3 SASI_Mm01_00151893 predicted 1146
4 SASI_Mm01_00151894 predicted 440
5 SASI_Mm01_00151895 predicted 907
6 SASI_Mm01_00151896 predicted 1198
7 SASI_Mm01_00151897 predicted 1206
8 SASI_Mm01_00151898 predicted 1216
9 SASI_Mm01_00151899 predicted 732
10 SASI_Mm01_00151900 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027797
VALIDATED
TMEM80 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 80
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027797.1-434s1c1
Sequence:CCGGCCTAGCTACACTCCTGATGATCTCGAGATCATCAGGAGTGTAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-425s1c1
Sequence:CCGGCCTGTACTTCCTAGCTACACTCTCGAGAGTGTAGCTAGGAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-438s1c1
Sequence:CCGGGCTACACTCCTGATGATTGTACTCGAGTACAATCATCAGGAGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-476s1c1
Sequence:CCGGCAGCTATCCTTGTAACTGTCTCTCGAGAGACAGTTACAAGGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027797.1-632s1c1
Sequence:CCGGCCTTTCTGTTCACTTCCTACTCTCGAGAGTAGGAAGTGAACAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027797.1-1335s1c1
Sequence:CCGGCTGAAATGAAACTGCTTGGTTCTCGAGAACCAAGCAGTTTCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-1156s21c1
Sequence:CCGGGTTTGCTCACACACGGATTACCTCGAGGTAATCCGTGTGTGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-848s21c1
Sequence:CCGGATCGTCTGTAGATAGTTTATACTCGAGTATAAACTATCTACAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027797.2-847s1c1
Sequence:CCGGGATCGTCTGTAGATAGTTTATCTCGAGATAAACTATCTACAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027797.3-760s21c1
Sequence:CCGGGTAGATGGAGCAGGGTAACCTCTCGAGAGGTTACCCTGCTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-475s21c1
Sequence:CCGGCAGCTATCCTTGTAACTGTCTCTCGAGAGACAGTTACAAGGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027797.3-437s21c1
Sequence:CCGGGCTACACTCCTGATGATTGTACTCGAGTACAATCATCAGGAGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027797
VALIDATED
TMEM80 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 80
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027797.1-434s1c1
Sequence:CCGGCCTAGCTACACTCCTGATGATCTCGAGATCATCAGGAGTGTAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-425s1c1
Sequence:CCGGCCTGTACTTCCTAGCTACACTCTCGAGAGTGTAGCTAGGAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-438s1c1
Sequence:CCGGGCTACACTCCTGATGATTGTACTCGAGTACAATCATCAGGAGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-476s1c1
Sequence:CCGGCAGCTATCCTTGTAACTGTCTCTCGAGAGACAGTTACAAGGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027797.1-632s1c1
Sequence:CCGGCCTTTCTGTTCACTTCCTACTCTCGAGAGTAGGAAGTGAACAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027797.1-1335s1c1
Sequence:CCGGCTGAAATGAAACTGCTTGGTTCTCGAGAACCAAGCAGTTTCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-1156s21c1
Sequence:CCGGGTTTGCTCACACACGGATTACCTCGAGGTAATCCGTGTGTGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-848s21c1
Sequence:CCGGATCGTCTGTAGATAGTTTATACTCGAGTATAAACTATCTACAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027797.2-847s1c1
Sequence:CCGGGATCGTCTGTAGATAGTTTATCTCGAGATAAACTATCTACAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027797.3-760s21c1
Sequence:CCGGGTAGATGGAGCAGGGTAACCTCTCGAGAGGTTACCCTGCTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-475s21c1
Sequence:CCGGCAGCTATCCTTGTAACTGTCTCTCGAGAGACAGTTACAAGGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027797.3-437s21c1
Sequence:CCGGGCTACACTCCTGATGATTGTACTCGAGTACAATCATCAGGAGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027797
VALIDATED
TMEM80 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 80
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027797.1-434s1c1
Sequence:CCGGCCTAGCTACACTCCTGATGATCTCGAGATCATCAGGAGTGTAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-425s1c1
Sequence:CCGGCCTGTACTTCCTAGCTACACTCTCGAGAGTGTAGCTAGGAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-438s1c1
Sequence:CCGGGCTACACTCCTGATGATTGTACTCGAGTACAATCATCAGGAGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027797.1-476s1c1
Sequence:CCGGCAGCTATCCTTGTAACTGTCTCTCGAGAGACAGTTACAAGGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027797.1-632s1c1
Sequence:CCGGCCTTTCTGTTCACTTCCTACTCTCGAGAGTAGGAAGTGAACAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027797.1-1335s1c1
Sequence:CCGGCTGAAATGAAACTGCTTGGTTCTCGAGAACCAAGCAGTTTCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-1156s21c1
Sequence:CCGGGTTTGCTCACACACGGATTACCTCGAGGTAATCCGTGTGTGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-848s21c1
Sequence:CCGGATCGTCTGTAGATAGTTTATACTCGAGTATAAACTATCTACAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027797.2-847s1c1
Sequence:CCGGGATCGTCTGTAGATAGTTTATCTCGAGATAAACTATCTACAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027797.3-760s21c1
Sequence:CCGGGTAGATGGAGCAGGGTAACCTCTCGAGAGGTTACCCTGCTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027797.3-475s21c1
Sequence:CCGGCAGCTATCCTTGTAACTGTCTCTCGAGAGACAGTTACAAGGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027797.3-437s21c1
Sequence:CCGGGCTACACTCCTGATGATTGTACTCGAGTACAATCATCAGGAGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174940
VALIDATED
TMEM80 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 80
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-359s1c1
Sequence:CCGGGATTCTAGAAGCAGTTCGGTTCTCGAGAACCGAACTGCTTCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-330s1c1
Sequence:CCGGCTCGATCTTGCTCTGCTGTTTCTCGAGAAACAGCAGAGCAAGATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-332s1c1
Sequence:CCGGCGATCTTGCTCTGCTGTTTCTCTCGAGAGAAACAGCAGAGCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-300s21c1
Sequence:CCGGCTCCTGATGATCACGTATAAACTCGAGTTTATACGTGATCATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-1222s21c1
Sequence:CCGGAGCTCTGCTGCCTAGCAATTTCTCGAGAAATTGCTAGGCAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-390s21c1
Sequence:CCGGCTAGAAGCAGTTCGGTTATACCTCGAGGTATAACCGAACTGCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-268s21c1
Sequence:CCGGGAACGTACTACGCCCTGTATTCTCGAGAATACAGGGCGTAGTACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-508s21c1
Sequence:CCGGTTTGGCAGGCCCTAGTGTTGTCTCGAGACAACACTAGGGCCTGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174940
VALIDATED
TMEM80 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 80
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-359s1c1
Sequence:CCGGGATTCTAGAAGCAGTTCGGTTCTCGAGAACCGAACTGCTTCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-330s1c1
Sequence:CCGGCTCGATCTTGCTCTGCTGTTTCTCGAGAAACAGCAGAGCAAGATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-332s1c1
Sequence:CCGGCGATCTTGCTCTGCTGTTTCTCTCGAGAGAAACAGCAGAGCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-300s21c1
Sequence:CCGGCTCCTGATGATCACGTATAAACTCGAGTTTATACGTGATCATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-1222s21c1
Sequence:CCGGAGCTCTGCTGCCTAGCAATTTCTCGAGAAATTGCTAGGCAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-390s21c1
Sequence:CCGGCTAGAAGCAGTTCGGTTATACCTCGAGGTATAACCGAACTGCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-268s21c1
Sequence:CCGGGAACGTACTACGCCCTGTATTCTCGAGAATACAGGGCGTAGTACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-508s21c1
Sequence:CCGGTTTGGCAGGCCCTAGTGTTGTCTCGAGACAACACTAGGGCCTGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174940
VALIDATED
TMEM80 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 80
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-359s1c1
Sequence:CCGGGATTCTAGAAGCAGTTCGGTTCTCGAGAACCGAACTGCTTCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-330s1c1
Sequence:CCGGCTCGATCTTGCTCTGCTGTTTCTCGAGAAACAGCAGAGCAAGATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174940.1-332s1c1
Sequence:CCGGCGATCTTGCTCTGCTGTTTCTCTCGAGAGAAACAGCAGAGCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-300s21c1
Sequence:CCGGCTCCTGATGATCACGTATAAACTCGAGTTTATACGTGATCATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-1222s21c1
Sequence:CCGGAGCTCTGCTGCCTAGCAATTTCTCGAGAAATTGCTAGGCAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-390s21c1
Sequence:CCGGCTAGAAGCAGTTCGGTTATACCTCGAGGTATAACCGAACTGCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-268s21c1
Sequence:CCGGGAACGTACTACGCCCTGTATTCTCGAGAATACAGGGCGTAGTACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_174940.2-508s21c1
Sequence:CCGGTTTGGCAGGCCCTAGTGTTGTCTCGAGACAACACTAGGGCCTGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks