EMAIL THIS PAGE TO A FRIEND

TMEM81

transmembrane protein 81

Synonyms: HC3107 KVLA2788 UNQ2788
UniProtKB ID: Q6P7N7, Q6UVZ4
Gene ID:
Mouse(74626) transmembrane protein 81
Rat(498229) transmembrane protein 81
chicken(771698) transmembrane protein 81
dog(488567) transmembrane protein 81
domestic cat(101084254) transmembrane protein 81
naked mole-rat(101712933) transmembrane protein 81
domestic guinea pig(100718969) transmembrane protein 81
cow(510784) transmembrane protein 81
sheep(101113609) transmembrane protein 81
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203376 Rosetta Predictions human pricing
NM_001017490 Rosetta Predictions rat pricing
NM_029025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118426 predicted 743
2 SASI_Hs01_00118427 predicted 679
3 SASI_Hs01_00118428 predicted 435
4 SASI_Hs02_00373303 predicted 1073
5 SASI_Hs01_00118429 predicted 584
6 SASI_Hs01_00118430 predicted 611
7 SASI_Hs01_00118431 predicted 713
8 SASI_Hs01_00118433 predicted 365
9 SASI_Hs01_00118434 predicted 588
10 SASI_Hs01_00118435 predicted 1073
11 SASI_Hs01_00118432 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105693 predicted 869
2 SASI_Rn01_00105694 predicted 1086
3 SASI_Rn01_00105695 predicted 924
4 SASI_Rn01_00105696 predicted 652
5 SASI_Rn01_00105697 predicted 714
6 SASI_Rn01_00105698 predicted 957
7 SASI_Rn01_00105699 predicted 903
8 SASI_Rn01_00105700 predicted 682
9 SASI_Rn01_00105701 predicted 469
10 SASI_Rn01_00105702 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047550 predicted 1146
2 SASI_Mm01_00047551 predicted 1092
3 SASI_Mm01_00047552 predicted 1090
4 SASI_Mm01_00047553 predicted 579
5 SASI_Mm01_00047554 predicted 1326
6 SASI_Mm01_00047555 predicted 842
7 SASI_Mm01_00047556 predicted 1211
8 SASI_Mm01_00047557 predicted 1088
9 SASI_Mm01_00047558 predicted 1139
10 SASI_Mm01_00047559 predicted 1366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029025
TMEM81 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 81
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029025.3-1058s21c1
Sequence:CCGGATTTGTCAAGAGGCTCTATTTCTCGAGAAATAGAGCCTCTTGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-689s1c1
Sequence:CCGGCCACAGGATGCAGTGTTACATCTCGAGATGTAACACTGCATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-1163s1c1
Sequence:CCGGGCTGGGAAGTTAATCTGGACACTCGAGTGTCCAGATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-588s1c1
Sequence:CCGGCCTTAGGAGTCTGTTATCAATCTCGAGATTGATAACAGACTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-1096s1c1
Sequence:CCGGCCTCCAAAGTTGGTAAACCTACTCGAGTAGGTTTACCAACTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029025.1-1557s1c1
Sequence:CCGGCCCTAGAGAGAGTTCTGTCTTCTCGAGAAGACAGAACTCTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029025
TMEM81 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 81
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029025.3-1058s21c1
Sequence:CCGGATTTGTCAAGAGGCTCTATTTCTCGAGAAATAGAGCCTCTTGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-689s1c1
Sequence:CCGGCCACAGGATGCAGTGTTACATCTCGAGATGTAACACTGCATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-1163s1c1
Sequence:CCGGGCTGGGAAGTTAATCTGGACACTCGAGTGTCCAGATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-588s1c1
Sequence:CCGGCCTTAGGAGTCTGTTATCAATCTCGAGATTGATAACAGACTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-1096s1c1
Sequence:CCGGCCTCCAAAGTTGGTAAACCTACTCGAGTAGGTTTACCAACTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029025.1-1557s1c1
Sequence:CCGGCCCTAGAGAGAGTTCTGTCTTCTCGAGAAGACAGAACTCTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029025
TMEM81 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 81
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029025.3-1058s21c1
Sequence:CCGGATTTGTCAAGAGGCTCTATTTCTCGAGAAATAGAGCCTCTTGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-689s1c1
Sequence:CCGGCCACAGGATGCAGTGTTACATCTCGAGATGTAACACTGCATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-1163s1c1
Sequence:CCGGGCTGGGAAGTTAATCTGGACACTCGAGTGTCCAGATTAACTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-588s1c1
Sequence:CCGGCCTTAGGAGTCTGTTATCAATCTCGAGATTGATAACAGACTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029025.1-1096s1c1
Sequence:CCGGCCTCCAAAGTTGGTAAACCTACTCGAGTAGGTTTACCAACTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029025.1-1557s1c1
Sequence:CCGGCCCTAGAGAGAGTTCTGTCTTCTCGAGAAGACAGAACTCTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203376
TMEM81 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 81
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203376.1-1080s1c1
Sequence:CCGGGCGCAGTAACCTAACTTCCTTCTCGAGAAGGAAGTTAGGTTACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203376.1-1082s1c1
Sequence:CCGGGCAGTAACCTAACTTCCTTATCTCGAGATAAGGAAGTTAGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-821s1c1
Sequence:CCGGCTTGGGAATAGGAATTGCCATCTCGAGATGGCAATTCCTATTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-534s1c1
Sequence:CCGGGATGAGGTCTTCAAACCCTTTCTCGAGAAAGGGTTTGAAGACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-594s1c1
Sequence:CCGGGAGTATGACTCTGGGACATATCTCGAGATATGTCCCAGAGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-430s1c1
Sequence:CCGGGCAAGGAATTTGAGCTTAGCTCTCGAGAGCTAAGCTCAAATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-449s1c1
Sequence:CCGGCTGTCTGAGTTCAGACATCTTCTCGAGAAGATGTCTGAACTCAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-711s1c1
Sequence:CCGGCATCAGTCACTTACTGAGGATCTCGAGATCCTCAGTAAGTGACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-533s1c1
Sequence:CCGGCGATGAGGTCTTCAAACCCTTCTCGAGAAGGGTTTGAAGACCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-407s1c1
Sequence:CCGGGCTCCATTTCACCATTCTCATCTCGAGATGAGAATGGTGAAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-455s1c1
Sequence:CCGGGAGTTCAGACATCTTGGAGTTCTCGAGAACTCCAAGATGTCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-687s1c1
Sequence:CCGGCCTAACTTGGTGAATCTGAATCTCGAGATTCAGATTCACCAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203376.1-1181s1c1
Sequence:CCGGGAGTTCTAAGAAGCTTGCATTCTCGAGAATGCAAGCTTCTTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203376
TMEM81 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 81
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203376.1-1080s1c1
Sequence:CCGGGCGCAGTAACCTAACTTCCTTCTCGAGAAGGAAGTTAGGTTACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203376.1-1082s1c1
Sequence:CCGGGCAGTAACCTAACTTCCTTATCTCGAGATAAGGAAGTTAGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-821s1c1
Sequence:CCGGCTTGGGAATAGGAATTGCCATCTCGAGATGGCAATTCCTATTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-534s1c1
Sequence:CCGGGATGAGGTCTTCAAACCCTTTCTCGAGAAAGGGTTTGAAGACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-594s1c1
Sequence:CCGGGAGTATGACTCTGGGACATATCTCGAGATATGTCCCAGAGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-430s1c1
Sequence:CCGGGCAAGGAATTTGAGCTTAGCTCTCGAGAGCTAAGCTCAAATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-449s1c1
Sequence:CCGGCTGTCTGAGTTCAGACATCTTCTCGAGAAGATGTCTGAACTCAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-711s1c1
Sequence:CCGGCATCAGTCACTTACTGAGGATCTCGAGATCCTCAGTAAGTGACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-533s1c1
Sequence:CCGGCGATGAGGTCTTCAAACCCTTCTCGAGAAGGGTTTGAAGACCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-407s1c1
Sequence:CCGGGCTCCATTTCACCATTCTCATCTCGAGATGAGAATGGTGAAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-455s1c1
Sequence:CCGGGAGTTCAGACATCTTGGAGTTCTCGAGAACTCCAAGATGTCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-687s1c1
Sequence:CCGGCCTAACTTGGTGAATCTGAATCTCGAGATTCAGATTCACCAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203376.1-1181s1c1
Sequence:CCGGGAGTTCTAAGAAGCTTGCATTCTCGAGAATGCAAGCTTCTTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203376
TMEM81 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 81
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122791    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203376.1-1080s1c1
Sequence:CCGGGCGCAGTAACCTAACTTCCTTCTCGAGAAGGAAGTTAGGTTACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203376.1-1082s1c1
Sequence:CCGGGCAGTAACCTAACTTCCTTATCTCGAGATAAGGAAGTTAGGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-821s1c1
Sequence:CCGGCTTGGGAATAGGAATTGCCATCTCGAGATGGCAATTCCTATTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-534s1c1
Sequence:CCGGGATGAGGTCTTCAAACCCTTTCTCGAGAAAGGGTTTGAAGACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-594s1c1
Sequence:CCGGGAGTATGACTCTGGGACATATCTCGAGATATGTCCCAGAGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-430s1c1
Sequence:CCGGGCAAGGAATTTGAGCTTAGCTCTCGAGAGCTAAGCTCAAATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-449s1c1
Sequence:CCGGCTGTCTGAGTTCAGACATCTTCTCGAGAAGATGTCTGAACTCAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-711s1c1
Sequence:CCGGCATCAGTCACTTACTGAGGATCTCGAGATCCTCAGTAAGTGACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-533s1c1
Sequence:CCGGCGATGAGGTCTTCAAACCCTTCTCGAGAAGGGTTTGAAGACCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203376.1-407s1c1
Sequence:CCGGGCTCCATTTCACCATTCTCATCTCGAGATGAGAATGGTGAAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-455s1c1
Sequence:CCGGGAGTTCAGACATCTTGGAGTTCTCGAGAACTCCAAGATGTCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203376.1-687s1c1
Sequence:CCGGCCTAACTTGGTGAATCTGAATCTCGAGATTCAGATTCACCAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203376.1-1181s1c1
Sequence:CCGGGAGTTCTAAGAAGCTTGCATTCTCGAGAATGCAAGCTTCTTAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks