EMAIL THIS PAGE TO A FRIEND

TMEM82

transmembrane protein 82

UniProtKB ID: A0PJX8, B2RP27, Q5VVD4
Gene ID:
Mouse(213989) transmembrane protein 82
Rat(298605) transmembrane protein 82
cow(508176) transmembrane protein 82
sheep(101109376) transmembrane protein 82
domestic guinea pig(100713842) transmembrane protein 82
naked mole-rat(101707952) transmembrane protein 82
chicken(771495) transmembrane protein 82
domestic cat(101084466) transmembrane protein 82
dog(487426) transmembrane protein 82
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013641 Rosetta Predictions human pricing
XM_001072960 Rosetta Predictions rat pricing
XM_238429 Rosetta Predictions rat pricing
NM_145987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207011 predicted 1183
2 SASI_Hs01_00207013 predicted 1205
3 SASI_Hs01_00207014 predicted 792
4 SASI_Hs01_00207015 predicted 656
5 SASI_Hs01_00207016 predicted 1177
6 SASI_Hs01_00207017 predicted 1182
7 SASI_Hs01_00207018 predicted 1208
8 SASI_Hs01_00207019 predicted 1057
9 SASI_Hs01_00207020 predicted 850
10 SASI_Hs02_00306412 predicted 1196
11 SASI_Hs01_00207012 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341121 predicted 1092
2 SASI_Rn02_00341122 predicted 815
3 SASI_Rn02_00341123 predicted 916
4 SASI_Rn02_00341124 predicted 707
5 SASI_Rn02_00341125 predicted 1080
6 SASI_Rn02_00341126 predicted 1307
7 SASI_Rn02_00341127 predicted 1093
8 SASI_Rn02_00341128 predicted 813
9 SASI_Rn02_00341129 predicted 1300
10 SASI_Rn02_00341130 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391336 predicted 1087
2 SASI_Rn02_00391337 predicted 816
3 SASI_Rn02_00391338 predicted 915
4 SASI_Rn02_00391339 predicted 710
5 SASI_Rn02_00391340 predicted 1080
6 SASI_Rn02_00391341 predicted 1306
7 SASI_Rn02_00391342 predicted 1093
8 SASI_Rn02_00391343 predicted 816
9 SASI_Rn02_00391344 predicted 1298
10 SASI_Rn02_00391345 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023082 predicted 1533
2 SASI_Mm01_00023083 predicted 1369
3 SASI_Mm02_00341502 predicted 1154
4 SASI_Mm01_00023084 predicted 1362
5 SASI_Mm01_00023085 predicted 846
6 SASI_Mm01_00023086 predicted 1547
7 SASI_Mm01_00023087 predicted 1758
8 SASI_Mm01_00023088 predicted 1784
9 SASI_Mm01_00023089 predicted 854
10 SASI_Mm01_00023090 predicted 1243
11 SASI_Mm01_00023091 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013641
TMEM82 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 82
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-267s1c1
Sequence:CCGGCCTGAAAGTTTACTTCTTCGTCTCGAGACGAAGAAGTAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-258s1c1
Sequence:CCGGGAACAGCCTCCTGAAAGTTTACTCGAGTAAACTTTCAGGAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-256s1c1
Sequence:CCGGCTGAACAGCCTCCTGAAAGTTCTCGAGAACTTTCAGGAGGCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-274s1c1
Sequence:CCGGGTTTACTTCTTCGTGGGCTGTCTCGAGACAGCCCACGAAGAAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-801s21c1
Sequence:CCGGCCTCATCAACCAGGACTTCCTCTCGAGAGGAAGTCCTGGTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-1101s21c1
Sequence:CCGGGCCTCCAGTGTCAACACCAAGCTCGAGCTTGGTGTTGACACTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013641.1-1309s21c1
Sequence:CCGGGAGAAGGGAAGGCAGGATTTGCTCGAGCAAATCCTGCCTTCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-867s21c1
Sequence:CCGCCTACACGCTGCTGGTCATCTACTCGAGTAGATGACCAGCAGCGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013641
TMEM82 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 82
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-267s1c1
Sequence:CCGGCCTGAAAGTTTACTTCTTCGTCTCGAGACGAAGAAGTAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-258s1c1
Sequence:CCGGGAACAGCCTCCTGAAAGTTTACTCGAGTAAACTTTCAGGAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-256s1c1
Sequence:CCGGCTGAACAGCCTCCTGAAAGTTCTCGAGAACTTTCAGGAGGCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-274s1c1
Sequence:CCGGGTTTACTTCTTCGTGGGCTGTCTCGAGACAGCCCACGAAGAAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-801s21c1
Sequence:CCGGCCTCATCAACCAGGACTTCCTCTCGAGAGGAAGTCCTGGTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-1101s21c1
Sequence:CCGGGCCTCCAGTGTCAACACCAAGCTCGAGCTTGGTGTTGACACTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013641.1-1309s21c1
Sequence:CCGGGAGAAGGGAAGGCAGGATTTGCTCGAGCAAATCCTGCCTTCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-867s21c1
Sequence:CCGCCTACACGCTGCTGGTCATCTACTCGAGTAGATGACCAGCAGCGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013641
TMEM82 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 82
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-267s1c1
Sequence:CCGGCCTGAAAGTTTACTTCTTCGTCTCGAGACGAAGAAGTAAACTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-258s1c1
Sequence:CCGGGAACAGCCTCCTGAAAGTTTACTCGAGTAAACTTTCAGGAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-256s1c1
Sequence:CCGGCTGAACAGCCTCCTGAAAGTTCTCGAGAACTTTCAGGAGGCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013641.1-274s1c1
Sequence:CCGGGTTTACTTCTTCGTGGGCTGTCTCGAGACAGCCCACGAAGAAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-801s21c1
Sequence:CCGGCCTCATCAACCAGGACTTCCTCTCGAGAGGAAGTCCTGGTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-1101s21c1
Sequence:CCGGGCCTCCAGTGTCAACACCAAGCTCGAGCTTGGTGTTGACACTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013641.1-1309s21c1
Sequence:CCGGGAGAAGGGAAGGCAGGATTTGCTCGAGCAAATCCTGCCTTCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013641.1-867s21c1
Sequence:CCGCCTACACGCTGCTGGTCATCTACTCGAGTAGATGACCAGCAGCGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145987
TMEM82 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 82
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145987.1-765s1c1
Sequence:CCGGCACCATCTGTTACACACTGTTCTCGAGAACAGTGTGTAACAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145987.1-1034s1c1
Sequence:CCGGCAGCAGAAGGAGAATCAGGATCTCGAGATCCTGATTCTCCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-889s21c1
Sequence:CCGGCCCTGTTCCTGACCTTGATAGCTCGAGCTATCAAGGTCAGGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-1503s21c1
Sequence:CCGGCTGGATCTCCTGAGTATCTTTCTCGAGAAAGATACTCAGGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-1553s21c1
Sequence:CCGGAGCCGGTATTCGCGCCTTAATCTCGAGATTAAGGCGCGAATACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-769s21c1
Sequence:CCGGACAGTCTCCTGAAAGTTTATTCTCGAGAATAAACTTTCAGGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145987.2-1729s21c1
Sequence:CCGGGGAGGATGTGAAGTCAGTTTCCTCGAGGAAACTGACTTCACATCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145987
TMEM82 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 82
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145987.1-765s1c1
Sequence:CCGGCACCATCTGTTACACACTGTTCTCGAGAACAGTGTGTAACAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145987.1-1034s1c1
Sequence:CCGGCAGCAGAAGGAGAATCAGGATCTCGAGATCCTGATTCTCCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-889s21c1
Sequence:CCGGCCCTGTTCCTGACCTTGATAGCTCGAGCTATCAAGGTCAGGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-1503s21c1
Sequence:CCGGCTGGATCTCCTGAGTATCTTTCTCGAGAAAGATACTCAGGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-1553s21c1
Sequence:CCGGAGCCGGTATTCGCGCCTTAATCTCGAGATTAAGGCGCGAATACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-769s21c1
Sequence:CCGGACAGTCTCCTGAAAGTTTATTCTCGAGAATAAACTTTCAGGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145987.2-1729s21c1
Sequence:CCGGGGAGGATGTGAAGTCAGTTTCCTCGAGGAAACTGACTTCACATCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145987
TMEM82 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 82
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145987.1-765s1c1
Sequence:CCGGCACCATCTGTTACACACTGTTCTCGAGAACAGTGTGTAACAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145987.1-1034s1c1
Sequence:CCGGCAGCAGAAGGAGAATCAGGATCTCGAGATCCTGATTCTCCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-889s21c1
Sequence:CCGGCCCTGTTCCTGACCTTGATAGCTCGAGCTATCAAGGTCAGGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-1503s21c1
Sequence:CCGGCTGGATCTCCTGAGTATCTTTCTCGAGAAAGATACTCAGGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-1553s21c1
Sequence:CCGGAGCCGGTATTCGCGCCTTAATCTCGAGATTAAGGCGCGAATACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145987.2-769s21c1
Sequence:CCGGACAGTCTCCTGAAAGTTTATTCTCGAGAATAAACTTTCAGGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145987.2-1729s21c1
Sequence:CCGGGGAGGATGTGAAGTCAGTTTCCTCGAGGAAACTGACTTCACATCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks