EMAIL THIS PAGE TO A FRIEND

TMEM86A

transmembrane protein 86A

UniProtKB ID: Q8N2M4, Q96AJ0
Gene ID:
Mouse(67893) transmembrane protein 86A
Rat(308602) transmembrane protein 86A
Zebrafish(541385) transmembrane protein 86A
chicken(428847) transmembrane protein 86A
domestic cat(101081162) transmembrane protein 86A
dog(485407) transmembrane protein 86A
naked mole-rat(101717551) transmembrane protein 86A
domestic guinea pig(100735970) transmembrane protein 86A
cow(532018) transmembrane protein 86A
sheep(101121641) transmembrane protein 86A
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153347 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153347 Rosetta Predictions human pricing
NM_001135016 Rosetta Predictions rat pricing
NM_026436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114846 predicted 686
2 SASI_Hs01_00114847 predicted 919
3 SASI_Hs01_00114850 predicted 620
4 SASI_Hs01_00114851 predicted 970
5 SASI_Hs01_00114852 predicted 1022
6 SASI_Hs02_00367206 predicted 965
7 SASI_Hs01_00114853 predicted 1154
8 SASI_Hs01_00114854 predicted 980
9 SASI_Hs01_00114855 predicted 655
10 SASI_Hs02_00367207 predicted 765
11 SASI_Hs01_00114848 predicted 911
12 SASI_Hs01_00114849 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259480 predicted 721
2 SASI_Rn02_00259481 predicted 496
3 SASI_Rn02_00259482 predicted 985
4 SASI_Rn02_00259483 predicted 964
5 SASI_Rn02_00259484 predicted 975
6 SASI_Rn02_00259485 predicted 389
7 SASI_Rn02_00259486 predicted 653
8 SASI_Rn02_00259487 predicted 204
9 SASI_Rn02_00259488 predicted 894
10 SASI_Rn02_00259489 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173336 predicted 1014
2 SASI_Mm01_00173337 predicted 1077
3 SASI_Mm01_00173338 predicted 747
4 SASI_Mm01_00173339 predicted 555
5 SASI_Mm01_00173340 predicted 1231
6 SASI_Mm01_00173341 predicted 849
7 SASI_Mm01_00173342 predicted 995
8 SASI_Mm01_00173343 predicted 1166
9 SASI_Mm01_00173344 predicted 782
10 SASI_Mm01_00173345 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153347
TMEM86A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 86A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153347.1-139s21c1
Sequence:CCGGTCAAGGCCACCTGCGTGTATTCTCGAGAATACACGCAGGTGGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153347.1-986s21c1
Sequence:CCGGAGGACAATGCTGAGAGCTAAACTCGAGTTTAGCTCTCAGCATTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-630s1c1
Sequence:CCGGGCACTCTTCTTTATCATCTCACTCGAGTGAGATGATAAAGAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153347.1-2413s1c1
Sequence:CCGGCCAGGAGCATTTGTAACTTAACTCGAGTTAAGTTACAAATGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153347.1-705s1c1
Sequence:CCGGCTTATCATGTCCACCTACTATCTCGAGATAGTAGGTGGACATGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-348s1c1
Sequence:CCGGGACCAAGGATACTTCGTGCATCTCGAGATGCACGAAGTATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-377s1c1
Sequence:CCGGGATGTTTGCTGTGACCCACATCTCGAGATGTGGGTCACAGCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153347.1-380s1c1
Sequence:CCGGGTTTGCTGTGACCCACATGTTCTCGAGAACATGTGGGTCACAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153347.1-1607s1c1
Sequence:CCGGGCCTATGTCTTTCTCTGCTATCTCGAGATAGCAGAGAAAGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153347
TMEM86A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 86A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153347.1-139s21c1
Sequence:CCGGTCAAGGCCACCTGCGTGTATTCTCGAGAATACACGCAGGTGGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153347.1-986s21c1
Sequence:CCGGAGGACAATGCTGAGAGCTAAACTCGAGTTTAGCTCTCAGCATTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-630s1c1
Sequence:CCGGGCACTCTTCTTTATCATCTCACTCGAGTGAGATGATAAAGAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153347.1-2413s1c1
Sequence:CCGGCCAGGAGCATTTGTAACTTAACTCGAGTTAAGTTACAAATGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153347.1-705s1c1
Sequence:CCGGCTTATCATGTCCACCTACTATCTCGAGATAGTAGGTGGACATGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-348s1c1
Sequence:CCGGGACCAAGGATACTTCGTGCATCTCGAGATGCACGAAGTATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-377s1c1
Sequence:CCGGGATGTTTGCTGTGACCCACATCTCGAGATGTGGGTCACAGCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153347.1-380s1c1
Sequence:CCGGGTTTGCTGTGACCCACATGTTCTCGAGAACATGTGGGTCACAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153347.1-1607s1c1
Sequence:CCGGGCCTATGTCTTTCTCTGCTATCTCGAGATAGCAGAGAAAGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153347
TMEM86A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 86A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153347.1-139s21c1
Sequence:CCGGTCAAGGCCACCTGCGTGTATTCTCGAGAATACACGCAGGTGGCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153347.1-986s21c1
Sequence:CCGGAGGACAATGCTGAGAGCTAAACTCGAGTTTAGCTCTCAGCATTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-630s1c1
Sequence:CCGGGCACTCTTCTTTATCATCTCACTCGAGTGAGATGATAAAGAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153347.1-2413s1c1
Sequence:CCGGCCAGGAGCATTTGTAACTTAACTCGAGTTAAGTTACAAATGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153347.1-705s1c1
Sequence:CCGGCTTATCATGTCCACCTACTATCTCGAGATAGTAGGTGGACATGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-348s1c1
Sequence:CCGGGACCAAGGATACTTCGTGCATCTCGAGATGCACGAAGTATCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153347.1-377s1c1
Sequence:CCGGGATGTTTGCTGTGACCCACATCTCGAGATGTGGGTCACAGCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153347.1-380s1c1
Sequence:CCGGGTTTGCTGTGACCCACATGTTCTCGAGAACATGTGGGTCACAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153347.1-1607s1c1
Sequence:CCGGGCCTATGTCTTTCTCTGCTATCTCGAGATAGCAGAGAAAGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026436
TMEM86A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 86A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-179s21c1
Sequence:CCGGCCAAACTGGTGCCCTTCTTTACTCGAGTAAAGAAGGGCACCAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-400s21c1
Sequence:CCGGTGGCAGGACCACGGATACTTTCTCGAGAAAGTATCCGTGGTCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-763s21c1
Sequence:CCGGCTGATCATGTCTACCTACTATCTCGAGATAGTAGGTAGACATGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-305s21c1
Sequence:CCGGTGGCTCATGGTGTTCGGTTTCCTCGAGGAAACCGAACACCATGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026436.3-1514s21c1
Sequence:CCGGGGGCCAGTCTCCAACTATATGCTCGAGCATATAGTTGGAGACTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026436.1-764s1c1
Sequence:CCGGCTGATCATGTCTACCTACTATCTCGAGATAGTAGGTAGACATGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026436.1-196s1c1
Sequence:CCGGCTTTAAGGCTACCTGTGTGTACTCGAGTACACACAGGTAGCCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026436
TMEM86A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 86A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-179s21c1
Sequence:CCGGCCAAACTGGTGCCCTTCTTTACTCGAGTAAAGAAGGGCACCAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-400s21c1
Sequence:CCGGTGGCAGGACCACGGATACTTTCTCGAGAAAGTATCCGTGGTCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-763s21c1
Sequence:CCGGCTGATCATGTCTACCTACTATCTCGAGATAGTAGGTAGACATGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-305s21c1
Sequence:CCGGTGGCTCATGGTGTTCGGTTTCCTCGAGGAAACCGAACACCATGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026436.3-1514s21c1
Sequence:CCGGGGGCCAGTCTCCAACTATATGCTCGAGCATATAGTTGGAGACTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026436.1-764s1c1
Sequence:CCGGCTGATCATGTCTACCTACTATCTCGAGATAGTAGGTAGACATGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026436.1-196s1c1
Sequence:CCGGCTTTAAGGCTACCTGTGTGTACTCGAGTACACACAGGTAGCCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026436
TMEM86A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 86A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-179s21c1
Sequence:CCGGCCAAACTGGTGCCCTTCTTTACTCGAGTAAAGAAGGGCACCAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-400s21c1
Sequence:CCGGTGGCAGGACCACGGATACTTTCTCGAGAAAGTATCCGTGGTCCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-763s21c1
Sequence:CCGGCTGATCATGTCTACCTACTATCTCGAGATAGTAGGTAGACATGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026436.3-305s21c1
Sequence:CCGGTGGCTCATGGTGTTCGGTTTCCTCGAGGAAACCGAACACCATGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026436.3-1514s21c1
Sequence:CCGGGGGCCAGTCTCCAACTATATGCTCGAGCATATAGTTGGAGACTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026436.1-764s1c1
Sequence:CCGGCTGATCATGTCTACCTACTATCTCGAGATAGTAGGTAGACATGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026436.1-196s1c1
Sequence:CCGGCTTTAAGGCTACCTGTGTGTACTCGAGTACACACAGGTAGCCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks