EMAIL THIS PAGE TO A FRIEND

TMEM86B

transmembrane protein 86B

UniProtKB ID: Q8N661
Gene ID:
Mouse(68255) transmembrane protein 86B
Rat(690610) transmembrane protein 86B
cow(518466) transmembrane protein 86B
sheep(101121701) transmembrane protein 86B
domestic guinea pig(100713815) transmembrane protein 86B
naked mole-rat(101720540) transmembrane protein 86B
Zebrafish(751651) transmembrane protein 86B
domestic cat(101092067) transmembrane protein 86B
dog(611345) transmembrane protein 86B
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173804 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU166211 MISSION® esiRNA esiRNA targeting mouse Tmem86b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173804 Rosetta Predictions human pricing
NM_001109604 Rosetta Predictions rat pricing
NM_023440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109792 predicted 703
2 SASI_Hs01_00109793 predicted 975
3 SASI_Hs01_00109794 predicted 1188
4 SASI_Hs01_00109795 predicted 975
5 SASI_Hs01_00109796 predicted 1114
6 SASI_Hs01_00109797 predicted 1198
7 SASI_Hs01_00109798 predicted 1366
8 SASI_Hs01_00109799 predicted 950
9 SASI_Hs01_00109800 predicted 977
10 SASI_Hs01_00109801 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250007 predicted 851
2 SASI_Rn02_00250008 predicted 837
3 SASI_Rn02_00250009 predicted 842
4 SASI_Rn02_00250010 predicted 897
5 SASI_Rn02_00250011 predicted 893
6 SASI_Rn02_00250012 predicted 796
7 SASI_Rn02_00250013 predicted 543
8 SASI_Rn02_00250014 predicted 578
9 SASI_Rn02_00250015 predicted 335
10 SASI_Rn02_00250016 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037524 predicted 996
2 SASI_Mm01_00037525 predicted 471
3 SASI_Mm01_00037526 predicted 837
4 SASI_Mm01_00037527 predicted 967
5 SASI_Mm01_00037528 predicted 993
6 SASI_Mm01_00037529 predicted 884
7 SASI_Mm01_00037530 predicted 666
8 SASI_Mm01_00037531 predicted 647
9 SASI_Mm01_00037532 predicted 654
10 SASI_Mm01_00037533 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173804
TMEM86B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 86B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173804.3-1351s1c1
Sequence:CCGGGAAGACGTTTGAGGACGATTTCTCGAGAAATCGTCCTCAAACGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-610s1c1
Sequence:CCGGCCTCTCCTGCTGCGTGTACTTCTCGAGAAGTACACGCAGCAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-847s1c1
Sequence:CCGGCCTCCTCTACGTCTGGGCCTTCTCGAGAAGGCCCAGACGTAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-1132s1c1
Sequence:CCGGGACCACCTACTATGCTGCCCACTCGAGTGGGCAGCATAGTAGGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-1051s1c1
Sequence:CCGGGCTGCTCTTCACGCTCTCTGACTCGAGTCAGAGAGCGTGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-1199s21c1
Sequence:CCGGGACTGACTAGGGAGCTTGAAGCTCGAGCTTCAAGCTCCCTAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-624s21c1
Sequence:CCGGTGTACTTCTGCCTCTGGATTCCTCGAGGAATCCAGAGGCAGAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173804.3-1285s21c1
Sequence:CCGGATACCCTCAGCAGCGAAGCTTCTCGAGAAGCTTCGCTGCTGAGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-1124s21c1
Sequence:CCGGGTGATCATGACCACCTACTATCTCGAGATAGTAGGTGGTCATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173804
TMEM86B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 86B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173804.3-1351s1c1
Sequence:CCGGGAAGACGTTTGAGGACGATTTCTCGAGAAATCGTCCTCAAACGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-610s1c1
Sequence:CCGGCCTCTCCTGCTGCGTGTACTTCTCGAGAAGTACACGCAGCAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-847s1c1
Sequence:CCGGCCTCCTCTACGTCTGGGCCTTCTCGAGAAGGCCCAGACGTAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-1132s1c1
Sequence:CCGGGACCACCTACTATGCTGCCCACTCGAGTGGGCAGCATAGTAGGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-1051s1c1
Sequence:CCGGGCTGCTCTTCACGCTCTCTGACTCGAGTCAGAGAGCGTGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-1199s21c1
Sequence:CCGGGACTGACTAGGGAGCTTGAAGCTCGAGCTTCAAGCTCCCTAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-624s21c1
Sequence:CCGGTGTACTTCTGCCTCTGGATTCCTCGAGGAATCCAGAGGCAGAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173804.3-1285s21c1
Sequence:CCGGATACCCTCAGCAGCGAAGCTTCTCGAGAAGCTTCGCTGCTGAGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-1124s21c1
Sequence:CCGGGTGATCATGACCACCTACTATCTCGAGATAGTAGGTGGTCATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173804
TMEM86B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 86B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173804.3-1351s1c1
Sequence:CCGGGAAGACGTTTGAGGACGATTTCTCGAGAAATCGTCCTCAAACGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-610s1c1
Sequence:CCGGCCTCTCCTGCTGCGTGTACTTCTCGAGAAGTACACGCAGCAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-847s1c1
Sequence:CCGGCCTCCTCTACGTCTGGGCCTTCTCGAGAAGGCCCAGACGTAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-1132s1c1
Sequence:CCGGGACCACCTACTATGCTGCCCACTCGAGTGGGCAGCATAGTAGGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173804.3-1051s1c1
Sequence:CCGGGCTGCTCTTCACGCTCTCTGACTCGAGTCAGAGAGCGTGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-1199s21c1
Sequence:CCGGGACTGACTAGGGAGCTTGAAGCTCGAGCTTCAAGCTCCCTAGTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-624s21c1
Sequence:CCGGTGTACTTCTGCCTCTGGATTCCTCGAGGAATCCAGAGGCAGAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173804.3-1285s21c1
Sequence:CCGGATACCCTCAGCAGCGAAGCTTCTCGAGAAGCTTCGCTGCTGAGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173804.3-1124s21c1
Sequence:CCGGGTGATCATGACCACCTACTATCTCGAGATAGTAGGTGGTCATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023440
TMEM86B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 86B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023440.1-736s1c1
Sequence:CCGGGCTGTGCTCTTTACATTCTCACTCGAGTGAGAATGTAAAGAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023440.1-310s1c1
Sequence:CCGGCTTTACTTCCTCCTCTGGATTCTCGAGAATCCAGAGGAGGAAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023440.1-998s1c1
Sequence:CCGGGCCATCTTTAACATCTGTATACTCGAGTATACAGATGTTAAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-733s21c1
Sequence:CCGGGGTGCTGTGCTCTTTACATTCCTCGAGGAATGTAAAGAGCACAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023440.2-1032s21c1
Sequence:CCGGTTCAGATCTACCACTGATTTCCTCGAGGAAATCAGTGGTAGATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-595s21c1
Sequence:CCGGACCTTGGCCTCTCTGACATACCTCGAGGTATGTCAGAGAGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-520s21c1
Sequence:CCGGTTCTCTGTTGCCCACTTATTCCTCGAGGAATAAGTGGGCAACAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-812s21c1
Sequence:CCGGTGACCATGAGCACCTACTATGCTCGAGCATAGTAGGTGCTCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023440
TMEM86B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 86B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023440.1-736s1c1
Sequence:CCGGGCTGTGCTCTTTACATTCTCACTCGAGTGAGAATGTAAAGAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023440.1-310s1c1
Sequence:CCGGCTTTACTTCCTCCTCTGGATTCTCGAGAATCCAGAGGAGGAAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023440.1-998s1c1
Sequence:CCGGGCCATCTTTAACATCTGTATACTCGAGTATACAGATGTTAAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-733s21c1
Sequence:CCGGGGTGCTGTGCTCTTTACATTCCTCGAGGAATGTAAAGAGCACAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023440.2-1032s21c1
Sequence:CCGGTTCAGATCTACCACTGATTTCCTCGAGGAAATCAGTGGTAGATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-595s21c1
Sequence:CCGGACCTTGGCCTCTCTGACATACCTCGAGGTATGTCAGAGAGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-520s21c1
Sequence:CCGGTTCTCTGTTGCCCACTTATTCCTCGAGGAATAAGTGGGCAACAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-812s21c1
Sequence:CCGGTGACCATGAGCACCTACTATGCTCGAGCATAGTAGGTGCTCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023440
TMEM86B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 86B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023440.1-736s1c1
Sequence:CCGGGCTGTGCTCTTTACATTCTCACTCGAGTGAGAATGTAAAGAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023440.1-310s1c1
Sequence:CCGGCTTTACTTCCTCCTCTGGATTCTCGAGAATCCAGAGGAGGAAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023440.1-998s1c1
Sequence:CCGGGCCATCTTTAACATCTGTATACTCGAGTATACAGATGTTAAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-733s21c1
Sequence:CCGGGGTGCTGTGCTCTTTACATTCCTCGAGGAATGTAAAGAGCACAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023440.2-1032s21c1
Sequence:CCGGTTCAGATCTACCACTGATTTCCTCGAGGAAATCAGTGGTAGATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-595s21c1
Sequence:CCGGACCTTGGCCTCTCTGACATACCTCGAGGTATGTCAGAGAGGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-520s21c1
Sequence:CCGGTTCTCTGTTGCCCACTTATTCCTCGAGGAATAAGTGGGCAACAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023440.2-812s21c1
Sequence:CCGGTGACCATGAGCACCTACTATGCTCGAGCATAGTAGGTGCTCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks