EMAIL THIS PAGE TO A FRIEND

TMEM87A

transmembrane protein 87A

UniProtKB ID: Q8NBN3, Q6NT77, Q8NCA4, Q9BS46, Q9P103, Q9Y3Y7
Gene ID:
Mouse(211499) transmembrane protein 87A
Rat(366170) transmembrane protein 87A
chicken(423231) transmembrane protein 87A
dog(612848) transmembrane protein 87A
Horse(100070982) transmembrane protein 87A
domestic cat(101082159) transmembrane protein 87A
naked mole-rat(101718177) transmembrane protein 87A
domestic guinea pig(100722468) transmembrane protein 87A
cow(615333) transmembrane protein 87A
sheep(101116912) transmembrane protein 87A
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001110496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015497 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110503 Rosetta Predictions human pricing
NM_015497 Rosetta Predictions human pricing
XM_001075817 Rosetta Predictions rat pricing
XM_345422 Rosetta Predictions rat pricing
NM_001110496 Rosetta Predictions mouse pricing
NM_001110497 Rosetta Predictions mouse pricing
NM_173734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324985 predicted 409
2 SASI_Hs02_00324986 predicted 214
3 SASI_Hs02_00324987 predicted 261
4 SASI_Hs02_00324988 predicted 381
5 SASI_Hs02_00324989 predicted 369
6 SASI_Hs02_00324990 predicted 368
7 SASI_Hs02_00324991 predicted 345
8 SASI_Hs02_00324992 predicted 362
9 SASI_Hs02_00324993 predicted 266
10 SASI_Hs02_00324994 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347965 predicted 414
2 SASI_Hs02_00347966 predicted 216
3 SASI_Hs02_00347967 predicted 261
4 SASI_Hs02_00347968 predicted 373
5 SASI_Hs02_00347969 predicted 375
6 SASI_Hs02_00347970 predicted 371
7 SASI_Hs01_00233529 predicted 342
8 SASI_Hs02_00347971 predicted 367
9 SASI_Hs02_00347972 predicted 260
10 SASI_Hs02_00347973 predicted 282
11 SASI_Hs01_00233521 predicted 1239
12 SASI_Hs01_00233522 predicted 692
13 SASI_Hs01_00233523 predicted 1651
14 SASI_Hs01_00233524 predicted 1544
15 SASI_Hs01_00233525 predicted 569
16 SASI_Hs01_00233526 predicted 1183
17 SASI_Hs01_00233527 predicted 1305
18 SASI_Hs01_00233528 predicted 596
19 SASI_Hs01_00233530 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351159 predicted 806
2 SASI_Rn02_00351160 predicted 1100
3 SASI_Rn02_00351161 predicted 1353
4 SASI_Rn02_00351162 predicted 777
5 SASI_Rn02_00351163 predicted 1133
6 SASI_Rn02_00351164 predicted 1270
7 SASI_Rn02_00351165 predicted 672
8 SASI_Rn02_00351166 predicted 1235
9 SASI_Rn02_00351167 predicted 1180
10 SASI_Rn02_00351168 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398347 predicted 376
2 SASI_Rn02_00398348 predicted 281
3 SASI_Rn02_00398349 predicted 1079
4 SASI_Rn02_00398350 predicted 1394
5 SASI_Rn02_00398351 predicted 179
6 SASI_Rn02_00398352 predicted 90
7 SASI_Rn02_00398353 predicted 165
8 SASI_Rn02_00398354 predicted 1070
9 SASI_Rn02_00398355 predicted 1325
10 SASI_Rn02_00398356 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305528 predicted 529
2 SASI_Mm02_00305529 predicted 418
3 SASI_Mm02_00305530 predicted 846
4 SASI_Mm02_00305531 predicted 277
5 SASI_Mm02_00305532 predicted 257
6 SASI_Mm02_00305533 predicted 249
7 SASI_Mm02_00305534 predicted 443
8 SASI_Mm02_00305535 predicted 355
9 SASI_Mm02_00305536 predicted 590
10 SASI_Mm02_00305537 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305538 predicted 528
2 SASI_Mm02_00305539 predicted 414
3 SASI_Mm02_00305540 predicted 849
4 SASI_Mm02_00305541 predicted 280
5 SASI_Mm02_00305542 predicted 249
6 SASI_Mm02_00305543 predicted 241
7 SASI_Mm02_00305544 predicted 437
8 SASI_Mm02_00305545 predicted 355
9 SASI_Mm02_00305546 predicted 590
10 SASI_Mm02_00305547 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345376 predicted 526
2 SASI_Mm02_00345377 predicted 416
3 SASI_Mm02_00345378 predicted 849
4 SASI_Mm01_00020097 predicted 282
5 SASI_Mm02_00345379 predicted 254
6 SASI_Mm01_00020098 predicted 249
7 SASI_Mm01_00020099 predicted 439
8 SASI_Mm02_00345380 predicted 355
9 SASI_Mm02_00345381 predicted 599
10 SASI_Mm02_00345382 predicted 266
11 SASI_Mm01_00020096 predicted 1543
12 SASI_Mm01_00020100 predicted 1553
13 SASI_Mm01_00020101 predicted 1376
14 SASI_Mm01_00020102 predicted 1313
15 SASI_Mm01_00020103 predicted 1155
16 SASI_Mm01_00020104 predicted 1688
17 SASI_Mm01_00020105 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110496
VALIDATED
TMEM87A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 87A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110496.1-2069s21c1
Sequence:CCGGGTGTCATTTACACCATAATTTCTCGAGAAATTATGGTGTAAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-1196s21c1
Sequence:CCGGGTGGATATTCATTAGCTTAACCTCGAGGTTAAGCTAATGAATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110496.1-1296s21c1
Sequence:CCGGTTGGCAGTGGCAGCGTCTATTCTCGAGAATAGACGCTGCCACTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-1259s21c1
Sequence:CCGGGCTCTCTTTGTACCGACATTTCTCGAGAAATGTCGGTACAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-767s21c1
Sequence:CCGGGTGTATTGTGTACGTACTATTCTCGAGAATAGTACGTACACAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110496
VALIDATED
TMEM87A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 87A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110496.1-2069s21c1
Sequence:CCGGGTGTCATTTACACCATAATTTCTCGAGAAATTATGGTGTAAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-1196s21c1
Sequence:CCGGGTGGATATTCATTAGCTTAACCTCGAGGTTAAGCTAATGAATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110496.1-1296s21c1
Sequence:CCGGTTGGCAGTGGCAGCGTCTATTCTCGAGAATAGACGCTGCCACTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-1259s21c1
Sequence:CCGGGCTCTCTTTGTACCGACATTTCTCGAGAAATGTCGGTACAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-767s21c1
Sequence:CCGGGTGTATTGTGTACGTACTATTCTCGAGAATAGTACGTACACAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110496
VALIDATED
TMEM87A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 87A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110496.1-2069s21c1
Sequence:CCGGGTGTCATTTACACCATAATTTCTCGAGAAATTATGGTGTAAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-1196s21c1
Sequence:CCGGGTGGATATTCATTAGCTTAACCTCGAGGTTAAGCTAATGAATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110496.1-1296s21c1
Sequence:CCGGTTGGCAGTGGCAGCGTCTATTCTCGAGAATAGACGCTGCCACTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-1259s21c1
Sequence:CCGGGCTCTCTTTGTACCGACATTTCTCGAGAAATGTCGGTACAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001110496.1-767s21c1
Sequence:CCGGGTGTATTGTGTACGTACTATTCTCGAGAATAGTACGTACACAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015497
VALIDATED
TMEM87A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 87A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-601s1c1
Sequence:CCGGGCATTTCATCCTCAAAGGAATCTCGAGATTCCTTTGAGGATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015497.2-2590s1c1
Sequence:CCGGGCTTCAGAAGTTGTAGCTTATCTCGAGATAAGCTACAACTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-1662s1c1
Sequence:CCGGGAACGAATGATCACACACTTTCTCGAGAAAGTGTGTGATCATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-515s1c1
Sequence:CCGGCCTTACCTTTATTGGAGACAACTCGAGTTGTCTCCAATAAAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-868s1c1
Sequence:CCGGCGGAATTTCAGAATATCCGATCTCGAGATCGGATATTCTGAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-541s1c1
Sequence:CCGGCAATGCATGAACCATTGCAAACTCGAGTTTGCAATGGTTCATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-209s1c1
Sequence:CCGGCCTCTTCAGAAATACCACTATCTCGAGATAGTGGTATTTCTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-855s1c1
Sequence:CCGGGCTGTCTTCTATGCGGAATTTCTCGAGAAATTCCGCATAGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-1100s1c1
Sequence:CCGGCCAGACTGATCTTGCTTCCTTCTCGAGAAGGAAGCAAGATCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015497.2-678s1c1
Sequence:CCGGCCCTATGAATACCTCACACTTCTCGAGAAGTGTGAGGTATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-1719s1c1
Sequence:CCGGGCAGTTAAAGATGGCTACCATCTCGAGATGGTAGCCATCTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015497
VALIDATED
TMEM87A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 87A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-601s1c1
Sequence:CCGGGCATTTCATCCTCAAAGGAATCTCGAGATTCCTTTGAGGATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015497.2-2590s1c1
Sequence:CCGGGCTTCAGAAGTTGTAGCTTATCTCGAGATAAGCTACAACTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-1662s1c1
Sequence:CCGGGAACGAATGATCACACACTTTCTCGAGAAAGTGTGTGATCATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-515s1c1
Sequence:CCGGCCTTACCTTTATTGGAGACAACTCGAGTTGTCTCCAATAAAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-868s1c1
Sequence:CCGGCGGAATTTCAGAATATCCGATCTCGAGATCGGATATTCTGAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-541s1c1
Sequence:CCGGCAATGCATGAACCATTGCAAACTCGAGTTTGCAATGGTTCATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-209s1c1
Sequence:CCGGCCTCTTCAGAAATACCACTATCTCGAGATAGTGGTATTTCTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-855s1c1
Sequence:CCGGGCTGTCTTCTATGCGGAATTTCTCGAGAAATTCCGCATAGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-1100s1c1
Sequence:CCGGCCAGACTGATCTTGCTTCCTTCTCGAGAAGGAAGCAAGATCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015497.2-678s1c1
Sequence:CCGGCCCTATGAATACCTCACACTTCTCGAGAAGTGTGAGGTATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-1719s1c1
Sequence:CCGGGCAGTTAAAGATGGCTACCATCTCGAGATGGTAGCCATCTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015497
VALIDATED
TMEM87A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 87A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-601s1c1
Sequence:CCGGGCATTTCATCCTCAAAGGAATCTCGAGATTCCTTTGAGGATGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015497.2-2590s1c1
Sequence:CCGGGCTTCAGAAGTTGTAGCTTATCTCGAGATAAGCTACAACTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-1662s1c1
Sequence:CCGGGAACGAATGATCACACACTTTCTCGAGAAAGTGTGTGATCATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-515s1c1
Sequence:CCGGCCTTACCTTTATTGGAGACAACTCGAGTTGTCTCCAATAAAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-868s1c1
Sequence:CCGGCGGAATTTCAGAATATCCGATCTCGAGATCGGATATTCTGAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-541s1c1
Sequence:CCGGCAATGCATGAACCATTGCAAACTCGAGTTTGCAATGGTTCATGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015497.2-209s1c1
Sequence:CCGGCCTCTTCAGAAATACCACTATCTCGAGATAGTGGTATTTCTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-855s1c1
Sequence:CCGGGCTGTCTTCTATGCGGAATTTCTCGAGAAATTCCGCATAGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-1100s1c1
Sequence:CCGGCCAGACTGATCTTGCTTCCTTCTCGAGAAGGAAGCAAGATCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015497.2-678s1c1
Sequence:CCGGCCCTATGAATACCTCACACTTCTCGAGAAGTGTGAGGTATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015497.2-1719s1c1
Sequence:CCGGGCAGTTAAAGATGGCTACCATCTCGAGATGGTAGCCATCTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks