EMAIL THIS PAGE TO A FRIEND

TMEM87B

transmembrane protein 87B

UniProtKB ID: Q96K49, A8K2M9, Q1RLN2, Q53R54
Gene ID:
Mouse(72477) transmembrane protein 87B
Rat(362212) transmembrane protein 87B
cow(617988) transmembrane protein 87B
sheep(101118520) transmembrane protein 87B
domestic guinea pig(100713812) transmembrane protein 87B
naked mole-rat(101718533) transmembrane protein 87B
Zebrafish(100322195) transmembrane protein 87B
Horse(100064755) transmembrane protein 87B
domestic cat(101083837) transmembrane protein 87B
dog(611784) transmembrane protein 87B
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032824 Rosetta Predictions human pricing
XM_001081122 Rosetta Predictions rat pricing
XM_342515 Rosetta Predictions rat pricing
NM_028248 Rosetta Predictions mouse pricing
XM_901720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111668 predicted 2025
2 SASI_Hs01_00111669 predicted 642
3 SASI_Hs01_00111670 predicted 2053
4 SASI_Hs01_00111671 predicted 806
5 SASI_Hs01_00111672 predicted 1195
6 SASI_Hs01_00111673 predicted 1333
7 SASI_Hs01_00111674 predicted 1184
8 SASI_Hs01_00111675 predicted 1475
9 SASI_Hs02_00360416 predicted 1970
10 SASI_Hs01_00111676 predicted 1423
11 SASI_Hs01_00111677 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370635 predicted 1719
2 SASI_Rn02_00370636 predicted 536
3 SASI_Rn02_00370637 predicted 522
4 SASI_Rn02_00370638 predicted 835
5 SASI_Rn02_00370639 predicted 1991
6 SASI_Rn02_00370640 predicted 576
7 SASI_Rn02_00370641 predicted 1113
8 SASI_Rn02_00370642 predicted 1712
9 SASI_Rn02_00370643 predicted 637
10 SASI_Rn02_00370644 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394409 predicted 1658
2 SASI_Rn02_00394410 predicted 487
3 SASI_Rn02_00394411 predicted 462
4 SASI_Rn02_00394412 predicted 777
5 SASI_Rn02_00394413 predicted 1935
6 SASI_Rn02_00394414 predicted 518
7 SASI_Rn02_00394415 predicted 1045
8 SASI_Rn02_00394416 predicted 1652
9 SASI_Rn02_00394417 predicted 582
10 SASI_Rn02_00394418 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333600 predicted 1370
2 SASI_Mm02_00333601 predicted 874
3 SASI_Mm02_00333602 predicted 1359
4 SASI_Mm02_00333603 predicted 296
5 SASI_Mm02_00333604 predicted 1067
6 SASI_Mm02_00333605 predicted 312
7 SASI_Mm02_00333606 predicted 194
8 SASI_Mm02_00333607 predicted 1163
9 SASI_Mm02_00333608 predicted 1110
10 SASI_Mm02_00333609 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283094 predicted 1881
2 SASI_Mm01_00283095 predicted 1071
3 SASI_Mm01_00283096 predicted 618
4 SASI_Mm01_00283097 predicted 1595
5 SASI_Mm01_00283098 predicted 494
6 SASI_Mm01_00283099 predicted 963
7 SASI_Mm01_00283100 predicted 513
8 SASI_Mm01_00283101 predicted 965
9 SASI_Mm01_00283102 predicted 487
10 SASI_Mm01_00283103 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032824
TMEM87B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 87B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-495s1c1
Sequence:CCGGGCTCTGGTTAGAGACAGTCAACTCGAGTTGACTGTCTCTAACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-513s1c1
Sequence:CCGGCAACGACAAATCAGGACCTTTCTCGAGAAAGGTCCTGATTTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1199s1c1
Sequence:CCGGGCTTATTGATATTTGCGGAGTCTCGAGACTCCGCAAATATCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1743s1c1
Sequence:CCGGGCCCTTAATAGATGATTCTGACTCGAGTCAGAATCATCTATTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1475s1c1
Sequence:CCGGCACAAACTATGAAGACCCTAACTCGAGTTAGGGTCTTCATAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032824.1-2398s1c1
Sequence:CCGGGTCACCTTTGAGGTAGATATTCTCGAGAATATCTACCTCAAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-633s1c1
Sequence:CCGGGAAGTATCATACCTGTCACAACTCGAGTTGTGACAGGTATGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032824.1-2630s1c1
Sequence:CCGGGCACATCAAATCATGGAGTTACTCGAGTAACTCCATGATTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-1858s1c1
Sequence:CCGGCCTGCCACTTCTGAGAACTTTCTCGAGAAAGTTCTCAGAAGTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032824
TMEM87B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 87B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-495s1c1
Sequence:CCGGGCTCTGGTTAGAGACAGTCAACTCGAGTTGACTGTCTCTAACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-513s1c1
Sequence:CCGGCAACGACAAATCAGGACCTTTCTCGAGAAAGGTCCTGATTTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1199s1c1
Sequence:CCGGGCTTATTGATATTTGCGGAGTCTCGAGACTCCGCAAATATCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1743s1c1
Sequence:CCGGGCCCTTAATAGATGATTCTGACTCGAGTCAGAATCATCTATTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1475s1c1
Sequence:CCGGCACAAACTATGAAGACCCTAACTCGAGTTAGGGTCTTCATAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032824.1-2398s1c1
Sequence:CCGGGTCACCTTTGAGGTAGATATTCTCGAGAATATCTACCTCAAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-633s1c1
Sequence:CCGGGAAGTATCATACCTGTCACAACTCGAGTTGTGACAGGTATGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032824.1-2630s1c1
Sequence:CCGGGCACATCAAATCATGGAGTTACTCGAGTAACTCCATGATTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-1858s1c1
Sequence:CCGGCCTGCCACTTCTGAGAACTTTCTCGAGAAAGTTCTCAGAAGTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032824
TMEM87B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 87B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-495s1c1
Sequence:CCGGGCTCTGGTTAGAGACAGTCAACTCGAGTTGACTGTCTCTAACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-513s1c1
Sequence:CCGGCAACGACAAATCAGGACCTTTCTCGAGAAAGGTCCTGATTTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1199s1c1
Sequence:CCGGGCTTATTGATATTTGCGGAGTCTCGAGACTCCGCAAATATCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1743s1c1
Sequence:CCGGGCCCTTAATAGATGATTCTGACTCGAGTCAGAATCATCTATTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032824.1-1475s1c1
Sequence:CCGGCACAAACTATGAAGACCCTAACTCGAGTTAGGGTCTTCATAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032824.1-2398s1c1
Sequence:CCGGGTCACCTTTGAGGTAGATATTCTCGAGAATATCTACCTCAAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-633s1c1
Sequence:CCGGGAAGTATCATACCTGTCACAACTCGAGTTGTGACAGGTATGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032824.1-2630s1c1
Sequence:CCGGGCACATCAAATCATGGAGTTACTCGAGTAACTCCATGATTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032824.1-1858s1c1
Sequence:CCGGCCTGCCACTTCTGAGAACTTTCTCGAGAAAGTTCTCAGAAGTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028248
VALIDATED
TMEM87B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 87B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028248.2-877s21c1
Sequence:CCGGACTCAAGGTTTACTGATATTTCTCGAGAAATATCAGTAAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-179s21c1
Sequence:CCGGTTTGGACGAGGACGGTCAATGCTCGAGCATTGACCGTCCTCGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-699s21c1
Sequence:CCGGTATGGTGATGTGTATCGTTTACTCGAGTAAACGATACACATCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-1536s21c1
Sequence:CCGGAGCTAAACCTACGTCTGATAACTCGAGTTATCAGACGTAGGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028248
VALIDATED
TMEM87B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 87B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028248.2-877s21c1
Sequence:CCGGACTCAAGGTTTACTGATATTTCTCGAGAAATATCAGTAAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-179s21c1
Sequence:CCGGTTTGGACGAGGACGGTCAATGCTCGAGCATTGACCGTCCTCGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-699s21c1
Sequence:CCGGTATGGTGATGTGTATCGTTTACTCGAGTAAACGATACACATCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-1536s21c1
Sequence:CCGGAGCTAAACCTACGTCTGATAACTCGAGTTATCAGACGTAGGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028248
VALIDATED
TMEM87B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 87B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028248.2-877s21c1
Sequence:CCGGACTCAAGGTTTACTGATATTTCTCGAGAAATATCAGTAAACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-179s21c1
Sequence:CCGGTTTGGACGAGGACGGTCAATGCTCGAGCATTGACCGTCCTCGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-699s21c1
Sequence:CCGGTATGGTGATGTGTATCGTTTACTCGAGTAAACGATACACATCACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028248.2-1536s21c1
Sequence:CCGGAGCTAAACCTACGTCTGATAACTCGAGTTATCAGACGTAGGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks