EMAIL THIS PAGE TO A FRIEND

TMEM88

transmembrane protein 88

UniProtKB ID: Q6PEY1
Gene ID:
Mouse(67020) transmembrane protein 88
Rat(497936) transmembrane protein 88
chicken(419414) transmembrane protein 88
dog(607946) transmembrane protein 88
naked mole-rat(101704029) transmembrane protein 88
domestic guinea pig(100734423) transmembrane protein 88
cow(507172) transmembrane protein 88
sheep(101104509) transmembrane protein 88
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203411 Rosetta Predictions human pricing
NM_001128155 Rosetta Predictions rat pricing
XM_573123 Rosetta Predictions rat pricing
NM_025915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118048 predicted 442
2 SASI_Hs02_00373340 predicted 519
3 SASI_Hs01_00118049 predicted 475
4 SASI_Hs01_00118050 predicted 269
5 SASI_Hs01_00118052 predicted 475
6 SASI_Hs01_00118053 predicted 479
7 SASI_Hs01_00118054 predicted 470
8 SASI_Hs01_00118055 predicted 604
9 SASI_Hs01_00118056 predicted 199
10 SASI_Hs02_00373341 predicted 583
11 SASI_Hs01_00118051 predicted 471
12 SASI_Hs01_00118057 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255010 predicted 592
2 SASI_Rn02_00255011 predicted 898
3 SASI_Rn02_00255012 predicted 940
4 SASI_Rn02_00255013 predicted 209
5 SASI_Rn02_00255014 predicted 427
6 SASI_Rn02_00255015 predicted 414
7 SASI_Rn02_00255016 predicted 538
8 SASI_Rn02_00255017 predicted 904
9 SASI_Rn02_00255018 predicted 909
10 SASI_Rn02_00255019 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123972 predicted 591
2 SASI_Rn01_00123973 predicted 269
3 SASI_Rn01_00123974 predicted 422
4 SASI_Rn01_00123975 predicted 412
5 SASI_Rn01_00123976 predicted 533
6 SASI_Rn01_00123977 predicted 448
7 SASI_Rn01_00123978 predicted 583
8 SASI_Rn01_00123979 predicted 523
9 SASI_Rn01_00123980 predicted 493
10 SASI_Rn01_00123981 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055786 predicted 436
2 SASI_Mm01_00055788 predicted 602
3 SASI_Mm01_00055789 predicted 410
4 SASI_Mm01_00055790 predicted 273
5 SASI_Mm02_00329270 predicted 478
6 SASI_Mm01_00055792 predicted 264
7 SASI_Mm01_00055791 predicted 211
8 SASI_Mm01_00055793 predicted 454
9 SASI_Mm01_00055794 predicted 92
10 SASI_Mm01_00055795 predicted 623
11 SASI_Mm01_00055787 predicted 525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203411
TMEM88 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 88
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-155s21c1
Sequence:CCGGTGCTAGGGACCATCTTGCTACCTCGAGGTAGCAAGATGGTCCCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-120s21c1
Sequence:CCGGGGTGGCTGCCTTCAATCTTCTCTCGAGAGAAGATTGAAGGCAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-382s21c1
Sequence:CCGGCCCTACAGCCGAGCCCTTTATCTCGAGATAAAGGGCTCGGCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-471s21c1
Sequence:CCGGAGGAAAGGTCTGGGTCTAATGCTCGAGCATTAGACCCAGACCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203411.1-704s21c1
Sequence:CCGGCCTGAACATCTAGGCTGGAACCTCGAGGTTCCAGCCTAGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-456s21c1
Sequence:CCGGGGCCGTTCCCACATCAGGAAACTCGAGTTTCCTGATGTGGGAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-677s1c1
Sequence:CCGGCTTTCCTTTCACGACCCACATCTCGAGATGTGGGTCGTGAAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-692s1c1
Sequence:CCGGCCACATCTCAATCCTGAACATCTCGAGATGTTCAGGATTGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203411.1-94s1c1
Sequence:CCGGGTTCTTGTAACAGCCCAGAATCTCGAGATTCTGGGCTGTTACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-691s1c1
Sequence:CCGGCCCACATCTCAATCCTGAACACTCGAGTGTTCAGGATTGAGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203411
TMEM88 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 88
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-155s21c1
Sequence:CCGGTGCTAGGGACCATCTTGCTACCTCGAGGTAGCAAGATGGTCCCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-120s21c1
Sequence:CCGGGGTGGCTGCCTTCAATCTTCTCTCGAGAGAAGATTGAAGGCAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-382s21c1
Sequence:CCGGCCCTACAGCCGAGCCCTTTATCTCGAGATAAAGGGCTCGGCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-471s21c1
Sequence:CCGGAGGAAAGGTCTGGGTCTAATGCTCGAGCATTAGACCCAGACCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203411.1-704s21c1
Sequence:CCGGCCTGAACATCTAGGCTGGAACCTCGAGGTTCCAGCCTAGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-456s21c1
Sequence:CCGGGGCCGTTCCCACATCAGGAAACTCGAGTTTCCTGATGTGGGAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-677s1c1
Sequence:CCGGCTTTCCTTTCACGACCCACATCTCGAGATGTGGGTCGTGAAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-692s1c1
Sequence:CCGGCCACATCTCAATCCTGAACATCTCGAGATGTTCAGGATTGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203411.1-94s1c1
Sequence:CCGGGTTCTTGTAACAGCCCAGAATCTCGAGATTCTGGGCTGTTACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-691s1c1
Sequence:CCGGCCCACATCTCAATCCTGAACACTCGAGTGTTCAGGATTGAGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203411
TMEM88 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 88
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-155s21c1
Sequence:CCGGTGCTAGGGACCATCTTGCTACCTCGAGGTAGCAAGATGGTCCCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-120s21c1
Sequence:CCGGGGTGGCTGCCTTCAATCTTCTCTCGAGAGAAGATTGAAGGCAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-382s21c1
Sequence:CCGGCCCTACAGCCGAGCCCTTTATCTCGAGATAAAGGGCTCGGCTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-471s21c1
Sequence:CCGGAGGAAAGGTCTGGGTCTAATGCTCGAGCATTAGACCCAGACCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203411.1-704s21c1
Sequence:CCGGCCTGAACATCTAGGCTGGAACCTCGAGGTTCCAGCCTAGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203411.1-456s21c1
Sequence:CCGGGGCCGTTCCCACATCAGGAAACTCGAGTTTCCTGATGTGGGAACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-677s1c1
Sequence:CCGGCTTTCCTTTCACGACCCACATCTCGAGATGTGGGTCGTGAAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-692s1c1
Sequence:CCGGCCACATCTCAATCCTGAACATCTCGAGATGTTCAGGATTGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203411.1-94s1c1
Sequence:CCGGGTTCTTGTAACAGCCCAGAATCTCGAGATTCTGGGCTGTTACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203411.1-691s1c1
Sequence:CCGGCCCACATCTCAATCCTGAACACTCGAGTGTTCAGGATTGAGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025915
VALIDATED
TMEM88 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 88
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.3-488s1c1
Sequence:CCGGGAGGTGCTTAGAGTCAAGAATCTCGAGATTCTTGACTCTAAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-166s1c1
Sequence:CCGGCATCTTGCTACCTGCTGTCATCTCGAGATGACAGCAGGTAGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-813s1c1
Sequence:CCGGGCTCACACAAATAAGAGAGAACTCGAGTTCTCTCTTATTTGTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-663s1c1
Sequence:CCGGCCCAGAAACGTCATTCACATTCTCGAGAATGTGAATGACGTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-281s1c1
Sequence:CCGGCTGTTGGTCACTGGATTCCTACTCGAGTAGGAATCCAGTGACCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.2-95s1c1
Sequence:CCGGGTGCTAGTAACGGCTCAGAATCTCGAGATTCTGAGCCGTTACTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.2-177s1c1
Sequence:CCGGCTGCTGTCATCATGTTAGGCTCTCGAGAGCCTAACATGATGACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025915
VALIDATED
TMEM88 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 88
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.3-488s1c1
Sequence:CCGGGAGGTGCTTAGAGTCAAGAATCTCGAGATTCTTGACTCTAAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-166s1c1
Sequence:CCGGCATCTTGCTACCTGCTGTCATCTCGAGATGACAGCAGGTAGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-813s1c1
Sequence:CCGGGCTCACACAAATAAGAGAGAACTCGAGTTCTCTCTTATTTGTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-663s1c1
Sequence:CCGGCCCAGAAACGTCATTCACATTCTCGAGAATGTGAATGACGTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-281s1c1
Sequence:CCGGCTGTTGGTCACTGGATTCCTACTCGAGTAGGAATCCAGTGACCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.2-95s1c1
Sequence:CCGGGTGCTAGTAACGGCTCAGAATCTCGAGATTCTGAGCCGTTACTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.2-177s1c1
Sequence:CCGGCTGCTGTCATCATGTTAGGCTCTCGAGAGCCTAACATGATGACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025915
VALIDATED
TMEM88 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 88
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.3-488s1c1
Sequence:CCGGGAGGTGCTTAGAGTCAAGAATCTCGAGATTCTTGACTCTAAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-166s1c1
Sequence:CCGGCATCTTGCTACCTGCTGTCATCTCGAGATGACAGCAGGTAGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-813s1c1
Sequence:CCGGGCTCACACAAATAAGAGAGAACTCGAGTTCTCTCTTATTTGTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-663s1c1
Sequence:CCGGCCCAGAAACGTCATTCACATTCTCGAGAATGTGAATGACGTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025915.2-281s1c1
Sequence:CCGGCTGTTGGTCACTGGATTCCTACTCGAGTAGGAATCCAGTGACCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.2-95s1c1
Sequence:CCGGGTGCTAGTAACGGCTCAGAATCTCGAGATTCTGAGCCGTTACTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025915.2-177s1c1
Sequence:CCGGCTGCTGTCATCATGTTAGGCTCTCGAGAGCCTAACATGATGACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks