EMAIL THIS PAGE TO A FRIEND

TMEM88B

transmembrane protein 88B

UniProtKB ID: A6NKF7
Gene ID:
Mouse(320587) transmembrane protein 88B
Rat(680723) transmembrane protein 88B
Zebrafish(100004517) transmembrane protein 88 b
dog(100684204) transmembrane protein 88B
domestic cat(101085789) transmembrane protein 88B
cow(767837) transmembrane protein 88B
sheep(101105345) transmembrane protein 88B
domestic guinea pig(101789060) transmembrane protein 88B
naked mole-rat(101710767) transmembrane protein 88B
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927219 Rosetta Predictions human pricing
NM_001109426 Rosetta Predictions rat pricing
NM_001033394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280740 predicted 39
2 SASI_Hs01_00280741 predicted 253
3 SASI_Hs01_00280742 predicted 251
4 SASI_Hs01_00280743 predicted 175
5 SASI_Hs01_00280744 predicted 264
6 SASI_Hs01_00280745 predicted 162
7 SASI_Hs01_00280746 predicted 245
8 SASI_Hs01_00280747 predicted 222
9 SASI_Hs01_00280748 predicted 162
10 SASI_Hs02_00480523 predicted 44
11 SASI_Hs01_00280739 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248287 predicted 1106
2 SASI_Rn02_00248288 predicted 361
3 SASI_Rn02_00248289 predicted 944
4 SASI_Rn02_00248290 predicted 428
5 SASI_Rn02_00248291 predicted 994
6 SASI_Rn02_00248292 predicted 499
7 SASI_Rn02_00248293 predicted 1148
8 SASI_Rn02_00248294 predicted 1169
9 SASI_Rn02_00248295 predicted 733
10 SASI_Rn02_00248296 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167941 predicted 272
2 SASI_Mm01_00167942 predicted 771
3 SASI_Mm01_00167943 predicted 347
4 SASI_Mm01_00167944 predicted 508
5 SASI_Mm01_00167945 predicted 408
6 SASI_Mm01_00167946 predicted 590
7 SASI_Mm01_00167947 predicted 332
8 SASI_Mm01_00167948 predicted 508
9 SASI_Mm01_00167949 predicted 799
10 SASI_Mm01_00167950 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033394
TMEM88B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 88B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-432s21c1
Sequence:CCGGCTAGTTGGGTTCCTGCTTCATCTCGAGATGAAGCAGGAACCCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-341s21c1
Sequence:CCGGCCGAAGAAGGCCTACTGATTACTCGAGTAATCAGTAGGCCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033394.2-1230s21c1
Sequence:CCGGGGATCGGCGTGTCGTTGTTAACTCGAGTTAACAACGACACGCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-522s21c1
Sequence:CCGGCTGTGTCACTCAAGGGTTCATCTCGAGATGAACCCTTGAGTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033394
TMEM88B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 88B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-432s21c1
Sequence:CCGGCTAGTTGGGTTCCTGCTTCATCTCGAGATGAAGCAGGAACCCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-341s21c1
Sequence:CCGGCCGAAGAAGGCCTACTGATTACTCGAGTAATCAGTAGGCCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033394.2-1230s21c1
Sequence:CCGGGGATCGGCGTGTCGTTGTTAACTCGAGTTAACAACGACACGCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-522s21c1
Sequence:CCGGCTGTGTCACTCAAGGGTTCATCTCGAGATGAACCCTTGAGTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033394
TMEM88B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 88B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-432s21c1
Sequence:CCGGCTAGTTGGGTTCCTGCTTCATCTCGAGATGAAGCAGGAACCCAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-341s21c1
Sequence:CCGGCCGAAGAAGGCCTACTGATTACTCGAGTAATCAGTAGGCCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033394.2-1230s21c1
Sequence:CCGGGGATCGGCGTGTCGTTGTTAACTCGAGTTAACAACGACACGCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033394.2-522s21c1
Sequence:CCGGCTGTGTCACTCAAGGGTTCATCTCGAGATGAACCCTTGAGTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks