EMAIL THIS PAGE TO A FRIEND

TMEM89

transmembrane protein 89

UniProtKB ID: A2RUT3
Gene ID:
Mouse(69384) transmembrane protein 89
Rat(501056) transmembrane protein 89
naked mole-rat(101720202) transmembrane protein 89
domestic guinea pig(100726588) transmembrane protein 89
cow(505670) transmembrane protein 89
cow(787776) transmembrane protein 89-like
sheep(101109833) transmembrane protein 89
dog(609007) transmembrane protein 89
domestic cat(101099443) transmembrane protein 89
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008269 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008269 Rosetta Predictions human pricing
XM_001075395 Rosetta Predictions rat pricing
XM_576472 Rosetta Predictions rat pricing
XM_135161 Rosetta Predictions mouse pricing
XM_982264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226719 predicted 230
2 SASI_Hs01_00226720 predicted 227
3 SASI_Hs01_00226721 predicted 210
4 SASI_Hs01_00226722 predicted 201
5 SASI_Hs01_00226723 predicted 203
6 SASI_Hs01_00226724 predicted 210
7 SASI_Hs01_00226725 predicted 201
8 SASI_Hs01_00226726 predicted 427
9 SASI_Hs01_00226727 predicted 149
10 SASI_Hs01_00226728 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349565 predicted 232
2 SASI_Rn02_00349566 predicted 207
3 SASI_Rn02_00349567 predicted 227
4 SASI_Rn02_00349568 predicted 217
5 SASI_Rn02_00349569 predicted 232
6 SASI_Rn02_00349570 predicted 230
7 SASI_Rn02_00349571 predicted 219
8 SASI_Rn02_00349572 predicted 259
9 SASI_Rn02_00349573 predicted 254
10 SASI_Rn02_00349574 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164454 predicted 225
2 SASI_Rn01_00164455 predicted 236
3 SASI_Rn01_00164456 predicted 209
4 SASI_Rn01_00164457 predicted 232
5 SASI_Rn01_00164458 predicted 228
6 SASI_Rn01_00164459 predicted 235
7 SASI_Rn01_00164460 predicted 242
8 SASI_Rn01_00164461 predicted 227
9 SASI_Rn01_00164462 predicted 235
10 SASI_Rn01_00164463 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424605 predicted 246
2 SASI_Mm01_00267929 predicted 377
3 SASI_Mm01_00267930 predicted 367
4 SASI_Mm01_00267931 predicted 347
5 SASI_Mm02_00424606 predicted 336
6 SASI_Mm02_00424607 predicted 198
7 SASI_Mm01_00267932 predicted 345
8 SASI_Mm01_00267933 predicted 281
9 SASI_Mm01_00267934 predicted 282
10 SASI_Mm01_00267935 predicted 270
11 SASI_Mm01_00267936 predicted 315
12 SASI_Mm01_00267937 predicted 284
13 SASI_Mm01_00267938 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447768 predicted 303
2 SASI_Mm02_00447769 predicted 298
3 SASI_Mm02_00447770 predicted 281
4 SASI_Mm02_00447771 predicted 264
5 SASI_Mm02_00447772 predicted 282
6 SASI_Mm02_00447773 predicted 207
7 SASI_Mm02_00447774 predicted 216
8 SASI_Mm02_00447775 predicted 269
9 SASI_Mm02_00447776 predicted 194
10 SASI_Mm02_00447777 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027066
TMEM89 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 89
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-43s21c1
Sequence:CCGGTCGCTGTTCCTGTTGGTGATGCTCGAGCATCACCAACAGGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-284s21c1
Sequence:CCGGTGGTTGTCAGCCGTGTGATAGCTCGAGCTATCACACGGCTGACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-135s21c1
Sequence:CCGGCCAGCCAAACAGCCCAGATATCTCGAGATATCTGGGCTGTTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-225s21c1
Sequence:CCGGCCTGGGAGGAAATCGCATCTACTCGAGTAGATGCGATTTCCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-313s21c1
Sequence:CCGGTGGCGAGCTAAGGTTGCTAAGCTCGAGCTTAGCAACCTTAGCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027066
TMEM89 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 89
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-43s21c1
Sequence:CCGGTCGCTGTTCCTGTTGGTGATGCTCGAGCATCACCAACAGGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-284s21c1
Sequence:CCGGTGGTTGTCAGCCGTGTGATAGCTCGAGCTATCACACGGCTGACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-135s21c1
Sequence:CCGGCCAGCCAAACAGCCCAGATATCTCGAGATATCTGGGCTGTTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-225s21c1
Sequence:CCGGCCTGGGAGGAAATCGCATCTACTCGAGTAGATGCGATTTCCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-313s21c1
Sequence:CCGGTGGCGAGCTAAGGTTGCTAAGCTCGAGCTTAGCAACCTTAGCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027066
TMEM89 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 89
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-43s21c1
Sequence:CCGGTCGCTGTTCCTGTTGGTGATGCTCGAGCATCACCAACAGGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-284s21c1
Sequence:CCGGTGGTTGTCAGCCGTGTGATAGCTCGAGCTATCACACGGCTGACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-135s21c1
Sequence:CCGGCCAGCCAAACAGCCCAGATATCTCGAGATATCTGGGCTGTTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-225s21c1
Sequence:CCGGCCTGGGAGGAAATCGCATCTACTCGAGTAGATGCGATTTCCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027066.1-313s21c1
Sequence:CCGGTGGCGAGCTAAGGTTGCTAAGCTCGAGCTTAGCAACCTTAGCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008269
TMEM89 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 89
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-117s21c1
Sequence:CCGGGTGTCAGCCAAAGAGTGTGGACTCGAGTCCACACTCTTTGGCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-216s21c1
Sequence:CCGGCATGATCACCACCACGATGCTCTCGAGAGCATCGTGGTGGTGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-236s21c1
Sequence:CCGGTGATGATCTGCCGCAAGATACCTCGAGGTATCTTGCGGCAGATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-224s21c1
Sequence:CCGGCCACCACGATGCTGATGATCTCTCGAGAGATCATCAGCATCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-206s21c1
Sequence:CCGGTGGCTGCGGTCATGATCACCACTCGAGTGGTGATCATGACCGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008269
TMEM89 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 89
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-117s21c1
Sequence:CCGGGTGTCAGCCAAAGAGTGTGGACTCGAGTCCACACTCTTTGGCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-216s21c1
Sequence:CCGGCATGATCACCACCACGATGCTCTCGAGAGCATCGTGGTGGTGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-236s21c1
Sequence:CCGGTGATGATCTGCCGCAAGATACCTCGAGGTATCTTGCGGCAGATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-224s21c1
Sequence:CCGGCCACCACGATGCTGATGATCTCTCGAGAGATCATCAGCATCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-206s21c1
Sequence:CCGGTGGCTGCGGTCATGATCACCACTCGAGTGGTGATCATGACCGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008269
TMEM89 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 89
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-117s21c1
Sequence:CCGGGTGTCAGCCAAAGAGTGTGGACTCGAGTCCACACTCTTTGGCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-216s21c1
Sequence:CCGGCATGATCACCACCACGATGCTCTCGAGAGCATCGTGGTGGTGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-236s21c1
Sequence:CCGGTGATGATCTGCCGCAAGATACCTCGAGGTATCTTGCGGCAGATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-224s21c1
Sequence:CCGGCCACCACGATGCTGATGATCTCTCGAGAGATCATCAGCATCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008269.1-206s21c1
Sequence:CCGGTGGCTGCGGTCATGATCACCACTCGAGTGGTGATCATGACCGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks