EMAIL THIS PAGE TO A FRIEND

TMEM8A

transmembrane protein 8A

Synonyms: M83 TMEM6 TMEM8
Gene ID:
Rat(303004) transmembrane protein 8A
Zebrafish(559126) transmembrane protein 8A
dog(479896) transmembrane protein 8A
Horse(100066625) transmembrane protein 8A
domestic cat(101095788) transmembrane protein 8A
chicken(427681) transmembrane protein 8A
cow(508215) transmembrane protein 8A
sheep(101122914) transmembrane protein 8A
domestic guinea pig(100718809) transmembrane protein 8A
naked mole-rat(101699844) transmembrane protein 8A
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021259 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024371 MISSION® esiRNA esiRNA human TMEM8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021259 Rosetta Predictions human pricing
NM_001106991 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103037 predicted 2001
2 SASI_Hs01_00103039 predicted 995
3 SASI_Hs01_00103040 predicted 1292
4 SASI_Hs02_00354920 predicted 2551
5 SASI_Hs01_00103041 predicted 414
6 SASI_Hs01_00103042 predicted 536
7 SASI_Hs01_00103044 predicted 2257
8 SASI_Hs01_00103045 predicted 1943
9 SASI_Hs01_00103046 predicted 2230
10 SASI_Hs02_00354921 predicted 1924
11 SASI_Hs01_00103038 predicted 1980
12 SASI_Hs01_00103043 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224406 predicted 1346
2 SASI_Rn02_00224407 predicted 2022
3 SASI_Rn02_00224408 predicted 2122
4 SASI_Rn02_00224409 predicted 1937
5 SASI_Rn02_00224410 predicted 2478
6 SASI_Rn02_00224411 predicted 751
7 SASI_Rn02_00224412 predicted 2296
8 SASI_Rn02_00224413 predicted 2430
9 SASI_Rn02_00224414 predicted 952
10 SASI_Rn02_00224415 predicted 2299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021259
VALIDATED
TMEM8A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 8A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-546s21c1
Sequence:CCGGCAATGCCTCCGTCAACGTTTCCTCGAGGAAACGTTGACGGAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-1664s21c1
Sequence:CCGGGCAGACACAGCTACCTGTATGCTCGAGCATACAGGTAGCTGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-683s21c1
Sequence:CCGGTCACGCGGGTGGTCGAGATTTCTCGAGAAATCTCGACCACCCGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021259.2-2554s21c1
Sequence:CCGGTTGGCCTAGATACCCTCTTACCTCGAGGTAAGAGGGTATCTAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021259.1-1967s1c1
Sequence:CCGGGCTCAAGACAGTCCTGAAATACTCGAGTATTTCAGGACTGTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1823s1c1
Sequence:CCGGCACCATGTTCTTCTCCACGTTCTCGAGAACGTGGAGAAGAACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1575s1c1
Sequence:CCGGCCCTGTTTGAACGATTGTGGACTCGAGTCCACAATCGTTCAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1304s1c1
Sequence:CCGGCAACAAGACAGAGATGCGGAACTCGAGTTCCGCATCTCTGTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-2219s1c1
Sequence:CCGGCATGATGACTAGCGACAACTACTCGAGTAGTTGTCGCTAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1826s1c1
Sequence:CCGGCATGTTCTTCTCCACGTTCTACTCGAGTAGAACGTGGAGAAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1367s1c1
Sequence:CCGGCCTTGGCTTCAATACTTCGCTCTCGAGAGCGAAGTATTGAAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1980s1c1
Sequence:CCGGCTGAAATACGTGCTGTTTCTTCTCGAGAAGAAACAGCACGTATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021259
VALIDATED
TMEM8A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 8A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-546s21c1
Sequence:CCGGCAATGCCTCCGTCAACGTTTCCTCGAGGAAACGTTGACGGAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-1664s21c1
Sequence:CCGGGCAGACACAGCTACCTGTATGCTCGAGCATACAGGTAGCTGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-683s21c1
Sequence:CCGGTCACGCGGGTGGTCGAGATTTCTCGAGAAATCTCGACCACCCGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021259.2-2554s21c1
Sequence:CCGGTTGGCCTAGATACCCTCTTACCTCGAGGTAAGAGGGTATCTAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021259.1-1967s1c1
Sequence:CCGGGCTCAAGACAGTCCTGAAATACTCGAGTATTTCAGGACTGTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1823s1c1
Sequence:CCGGCACCATGTTCTTCTCCACGTTCTCGAGAACGTGGAGAAGAACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1575s1c1
Sequence:CCGGCCCTGTTTGAACGATTGTGGACTCGAGTCCACAATCGTTCAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1304s1c1
Sequence:CCGGCAACAAGACAGAGATGCGGAACTCGAGTTCCGCATCTCTGTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-2219s1c1
Sequence:CCGGCATGATGACTAGCGACAACTACTCGAGTAGTTGTCGCTAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1826s1c1
Sequence:CCGGCATGTTCTTCTCCACGTTCTACTCGAGTAGAACGTGGAGAAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1367s1c1
Sequence:CCGGCCTTGGCTTCAATACTTCGCTCTCGAGAGCGAAGTATTGAAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1980s1c1
Sequence:CCGGCTGAAATACGTGCTGTTTCTTCTCGAGAAGAAACAGCACGTATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021259
VALIDATED
TMEM8A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 8A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-546s21c1
Sequence:CCGGCAATGCCTCCGTCAACGTTTCCTCGAGGAAACGTTGACGGAGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-1664s21c1
Sequence:CCGGGCAGACACAGCTACCTGTATGCTCGAGCATACAGGTAGCTGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021259.2-683s21c1
Sequence:CCGGTCACGCGGGTGGTCGAGATTTCTCGAGAAATCTCGACCACCCGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021259.2-2554s21c1
Sequence:CCGGTTGGCCTAGATACCCTCTTACCTCGAGGTAAGAGGGTATCTAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021259.1-1967s1c1
Sequence:CCGGGCTCAAGACAGTCCTGAAATACTCGAGTATTTCAGGACTGTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1823s1c1
Sequence:CCGGCACCATGTTCTTCTCCACGTTCTCGAGAACGTGGAGAAGAACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1575s1c1
Sequence:CCGGCCCTGTTTGAACGATTGTGGACTCGAGTCCACAATCGTTCAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1304s1c1
Sequence:CCGGCAACAAGACAGAGATGCGGAACTCGAGTTCCGCATCTCTGTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-2219s1c1
Sequence:CCGGCATGATGACTAGCGACAACTACTCGAGTAGTTGTCGCTAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021259.1-1826s1c1
Sequence:CCGGCATGTTCTTCTCCACGTTCTACTCGAGTAGAACGTGGAGAAGAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1367s1c1
Sequence:CCGGCCTTGGCTTCAATACTTCGCTCTCGAGAGCGAAGTATTGAAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021259.1-1980s1c1
Sequence:CCGGCTGAAATACGTGCTGTTTCTTCTCGAGAAGAAACAGCACGTATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks