EMAIL THIS PAGE TO A FRIEND

TMEM8B

transmembrane protein 8B

Synonyms: C9orf127 NAG-5 NGX6 RP11-112J3.10
Gene ID:
Mouse(242409) transmembrane protein 8B
Rat(313490) transmembrane protein 8B
naked mole-rat(101715100) transmembrane protein 8B
cow(100125302) transmembrane protein 8B
sheep(101112025) transmembrane protein 8B
chicken(769808) transmembrane protein 8B
dog(611963) transmembrane protein 8A-like
domestic cat(101095051) transmembrane protein 8B
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41900 Anti-C9ORF127 (AB1) antibody produced in rabbit affinity isolated antibody horse, bovine, rat, mouse, rabbit, human, canine, guinea pig
immunohistochemistry, western blot pricing
AV41903 Anti-C9ORF127 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, bovine, mouse, guinea pig, rabbit, human, rat, canine
western blot pricing
AV41902 Anti-C9ORF127 (AB2) antibody produced in rabbit affinity isolated antibody human, canine, guinea pig, zebrafish, mouse, rat, horse, rabbit, bovine
western blot pricing
AV42472 Anti-C9ORF127 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, mouse, canine, rat, horse, human, guinea pig
immunohistochemistry, western blot pricing
HPA052130 Anti-TMEM8B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA062701 Anti-TMEM8B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4301044 Anti-TMEM8B antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086121 MISSION® esiRNA esiRNA human C9orf127 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042589 Rosetta Predictions human pricing
NM_001042590 Rosetta Predictions human pricing
NM_016446 Rosetta Predictions human pricing
XM_001070176 Rosetta Predictions rat pricing
XM_233376 Rosetta Predictions rat pricing
NM_001085508 Rosetta Predictions mouse pricing
XM_621622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310708 predicted 1367
2 SASI_Hs02_00310709 predicted 1217
3 SASI_Hs02_00310710 predicted 1315
4 SASI_Hs02_00310711 predicted 1133
5 SASI_Hs02_00310712 predicted 1227
6 SASI_Hs02_00310713 predicted 1161
7 SASI_Hs02_00310714 predicted 1148
8 SASI_Hs02_00310715 predicted 1595
9 SASI_Hs02_00310716 predicted 1234
10 SASI_Hs02_00310717 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310718 predicted 1633
2 SASI_Hs02_00310719 predicted 1487
3 SASI_Hs02_00310720 predicted 1594
4 SASI_Hs02_00310721 predicted 1411
5 SASI_Hs02_00310722 predicted 1496
6 SASI_Hs02_00310723 predicted 1436
7 SASI_Hs02_00310724 predicted 1424
8 SASI_Hs02_00310725 predicted 1872
9 SASI_Hs02_00310726 predicted 1510
10 SASI_Hs02_00310727 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349476 predicted 1440
2 SASI_Hs01_00094339 predicted 1295
3 SASI_Hs02_00349477 predicted 1394
4 SASI_Hs01_00094340 predicted 1217
5 SASI_Hs01_00094341 predicted 1305
6 SASI_Hs02_00349478 predicted 1235
7 SASI_Hs01_00094342 predicted 1230
8 SASI_Hs01_00094343 predicted 1672
9 SASI_Hs02_00349479 predicted 1315
10 SASI_Hs01_00094345 predicted 1449
11 SASI_Hs01_00094338 predicted 1847
12 SASI_Hs01_00094344 predicted 1863
13 SASI_Hs01_00094346 predicted 1412
14 SASI_Hs01_00094347 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330682 predicted 1143
2 SASI_Rn02_00330683 predicted 1642
3 SASI_Rn02_00330684 predicted 1625
4 SASI_Rn02_00330685 predicted 1888
5 SASI_Rn02_00330686 predicted 278
6 SASI_Rn02_00330687 predicted 235
7 SASI_Rn02_00330688 predicted 890
8 SASI_Rn02_00330689 predicted 1632
9 SASI_Rn02_00330690 predicted 341
10 SASI_Rn02_00330691 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387712 predicted 1642
2 SASI_Rn02_00387713 predicted 1330
3 SASI_Rn02_00387714 predicted 1621
4 SASI_Rn02_00387715 predicted 1425
5 SASI_Rn02_00387716 predicted 1845
6 SASI_Rn02_00387717 predicted 1496
7 SASI_Rn02_00387718 predicted 1899
8 SASI_Rn02_00387719 predicted 1518
9 SASI_Rn02_00387720 predicted 1596
10 SASI_Rn02_00387721 predicted 1866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300662 predicted 1935
2 SASI_Mm02_00300663 predicted 2642
3 SASI_Mm02_00300664 predicted 2278
4 SASI_Mm02_00300665 predicted 2624
5 SASI_Mm02_00300666 predicted 2375
6 SASI_Mm02_00300667 predicted 2042
7 SASI_Mm02_00300668 predicted 2619
8 SASI_Mm02_00300669 predicted 2577
9 SASI_Mm02_00300670 predicted 2656
10 SASI_Mm02_00300671 predicted 2262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272437 predicted 2235
2 SASI_Mm01_00272438 predicted 2220
3 SASI_Mm01_00272439 predicted 2573
4 SASI_Mm01_00272440 predicted 2931
5 SASI_Mm01_00272441 predicted 2674
6 SASI_Mm01_00272442 predicted 2338
7 SASI_Mm01_00272443 predicted 2913
8 SASI_Mm01_00272444 predicted 2874
9 SASI_Mm01_00272445 predicted 2958
10 SASI_Mm01_00272446 predicted 2564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016446
TMEM8B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 8B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1814s1c1
Sequence:CCGGCATTCGGAGTCGATATGTGCTCTCGAGAGCACATATCGACTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1204s1c1
Sequence:CCGGCTGTCCACTTCTACATCTTCTCTCGAGAGAAGATGTAGAAGTGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1858s1c1
Sequence:CCGGCCATGTTCTTCTCCACGGTATCTCGAGATACCGTGGAGAAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1974s1c1
Sequence:CCGGGTGCCTTCACTGTGTCTTCTACTCGAGTAGAAGACACAGTGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016446.2-1887s1c1
Sequence:CCGGGTCTGCATCTTATCACTGGGTCTCGAGACCCAGTGATAAGATGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1217s1c1
Sequence:CCGGCATCTTCTTTGGCCCAAGTGTCTCGAGACACTTGGGCCAAAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016446.3-1767s21c1
Sequence:CCGGGATGCGCTCACCTATGGATTCCTCGAGGAATCCATAGGTGAGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016446.3-2088s21c1
Sequence:CCGGTGTAAGACACATTGGAGTAAACTCGAGTTTACTCCAATGTGTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016446
TMEM8B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 8B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1814s1c1
Sequence:CCGGCATTCGGAGTCGATATGTGCTCTCGAGAGCACATATCGACTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1204s1c1
Sequence:CCGGCTGTCCACTTCTACATCTTCTCTCGAGAGAAGATGTAGAAGTGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1858s1c1
Sequence:CCGGCCATGTTCTTCTCCACGGTATCTCGAGATACCGTGGAGAAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1974s1c1
Sequence:CCGGGTGCCTTCACTGTGTCTTCTACTCGAGTAGAAGACACAGTGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016446.2-1887s1c1
Sequence:CCGGGTCTGCATCTTATCACTGGGTCTCGAGACCCAGTGATAAGATGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1217s1c1
Sequence:CCGGCATCTTCTTTGGCCCAAGTGTCTCGAGACACTTGGGCCAAAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016446.3-1767s21c1
Sequence:CCGGGATGCGCTCACCTATGGATTCCTCGAGGAATCCATAGGTGAGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016446.3-2088s21c1
Sequence:CCGGTGTAAGACACATTGGAGTAAACTCGAGTTTACTCCAATGTGTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016446
TMEM8B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 8B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1814s1c1
Sequence:CCGGCATTCGGAGTCGATATGTGCTCTCGAGAGCACATATCGACTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1204s1c1
Sequence:CCGGCTGTCCACTTCTACATCTTCTCTCGAGAGAAGATGTAGAAGTGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1858s1c1
Sequence:CCGGCCATGTTCTTCTCCACGGTATCTCGAGATACCGTGGAGAAGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1974s1c1
Sequence:CCGGGTGCCTTCACTGTGTCTTCTACTCGAGTAGAAGACACAGTGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016446.2-1887s1c1
Sequence:CCGGGTCTGCATCTTATCACTGGGTCTCGAGACCCAGTGATAAGATGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016446.2-1217s1c1
Sequence:CCGGCATCTTCTTTGGCCCAAGTGTCTCGAGACACTTGGGCCAAAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016446.3-1767s21c1
Sequence:CCGGGATGCGCTCACCTATGGATTCCTCGAGGAATCCATAGGTGAGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016446.3-2088s21c1
Sequence:CCGGTGTAAGACACATTGGAGTAAACTCGAGTTTACTCCAATGTGTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085508
TMEM8B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 8B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2006s21c1
Sequence:CCGGTGATCAAGCAGGTGCTGTATCCTCGAGGATACAGCACCTGCTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085508.2-3370s21c1
Sequence:CCGGATTAGAGTAACAGGTACAAATCTCGAGATTTGTACCTGTTACTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2384s21c1
Sequence:CCGGGTTACCAGCTGTGCATCAATGCTCGAGCATTGATGCACAGCTGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-1941s21c1
Sequence:CCGGTGATTTCCTGGGCTCCTTAATCTCGAGATTAAGGAGCCCAGGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2258s21c1
Sequence:CCGGGGGACAACTACTTCTACATTCCTCGAGGAATGTAGAAGTAGTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085508
TMEM8B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 8B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2006s21c1
Sequence:CCGGTGATCAAGCAGGTGCTGTATCCTCGAGGATACAGCACCTGCTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085508.2-3370s21c1
Sequence:CCGGATTAGAGTAACAGGTACAAATCTCGAGATTTGTACCTGTTACTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2384s21c1
Sequence:CCGGGTTACCAGCTGTGCATCAATGCTCGAGCATTGATGCACAGCTGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-1941s21c1
Sequence:CCGGTGATTTCCTGGGCTCCTTAATCTCGAGATTAAGGAGCCCAGGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2258s21c1
Sequence:CCGGGGGACAACTACTTCTACATTCCTCGAGGAATGTAGAAGTAGTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085508
TMEM8B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 8B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2006s21c1
Sequence:CCGGTGATCAAGCAGGTGCTGTATCCTCGAGGATACAGCACCTGCTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085508.2-3370s21c1
Sequence:CCGGATTAGAGTAACAGGTACAAATCTCGAGATTTGTACCTGTTACTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2384s21c1
Sequence:CCGGGTTACCAGCTGTGCATCAATGCTCGAGCATTGATGCACAGCTGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-1941s21c1
Sequence:CCGGTGATTTCCTGGGCTCCTTAATCTCGAGATTAAGGAGCCCAGGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085508.2-2258s21c1
Sequence:CCGGGGGACAACTACTTCTACATTCCTCGAGGAATGTAGAAGTAGTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks