EMAIL THIS PAGE TO A FRIEND

TMEM8C

transmembrane protein 8C

Synonyms: MYOMAKER TMEM226
UniProtKB ID: A6NI61
Gene ID:
Mouse(66139) transmembrane protein 8C
Rat(296601) transmembrane protein 8C
Zebrafish(415178) transmembrane protein 8C
chicken(777472) transmembrane protein 8C
domestic cat(101083465) transmembrane protein 8C
dog(491275) transmembrane protein 8C
cow(614755) transmembrane protein 8C
sheep(101111445) transmembrane protein 8C
domestic guinea pig(100717949) transmembrane protein 8C
naked mole-rat(101716250) transmembrane protein 8C
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067031 MISSION® esiRNA esiRNA targeting mouse 1110002H13Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080483 Rosetta Predictions human pricing
XM_372180 Rosetta Predictions human pricing
NM_001134517 Rosetta Predictions rat pricing
NM_025376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315276 predicted 247
2 SASI_Hs02_00315277 predicted 436
3 SASI_Hs02_00315278 predicted 387
4 SASI_Hs02_00315279 predicted 380
5 SASI_Hs02_00315280 predicted 261
6 SASI_Hs02_00315281 predicted 443
7 SASI_Hs02_00315282 predicted 298
8 SASI_Hs02_00315283 predicted 389
9 SASI_Hs02_00315284 predicted 383
10 SASI_Hs02_00315285 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290433 predicted 259
2 SASI_Hs01_00290434 predicted 393
3 SASI_Hs01_00290435 predicted 385
4 SASI_Hs01_00290436 predicted 270
5 SASI_Hs01_00290437 predicted 269
6 SASI_Hs01_00290438 predicted 309
7 SASI_Hs01_00290439 predicted 323
8 SASI_Hs01_00290440 predicted 260
9 SASI_Hs01_00290441 predicted 271
10 SASI_Hs01_00290442 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256659 predicted 842
2 SASI_Rn02_00256660 predicted 720
3 SASI_Rn02_00256661 predicted 835
4 SASI_Rn02_00256662 predicted 817
5 SASI_Rn02_00256663 predicted 816
6 SASI_Rn02_00256664 predicted 716
7 SASI_Rn02_00256665 predicted 841
8 SASI_Rn02_00256666 predicted 776
9 SASI_Rn02_00256667 predicted 716
10 SASI_Rn02_00256668 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047277 predicted 419
2 SASI_Mm01_00047278 predicted 515
3 SASI_Mm01_00047280 predicted 328
4 SASI_Mm01_00047283 predicted 211
5 SASI_Mm01_00047284 predicted 337
6 SASI_Mm01_00047285 predicted 582
7 SASI_Mm02_00328103 predicted 422
8 SASI_Mm02_00328104 predicted 265
9 SASI_Mm02_00328105 predicted 421
10 SASI_Mm02_00328106 predicted 385
11 SASI_Mm01_00047279 predicted 272
12 SASI_Mm01_00047281 predicted 205
13 SASI_Mm01_00047282 predicted 320
14 SASI_Mm01_00047286 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080483
TMEM8C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 8C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-268s21c1
Sequence:CCGGGAACCCAAGAGGTCAACATTTCTCGAGAAATGTTGACCTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-376s21c1
Sequence:CCGGATCCTCATCATCGCGGCAAAGCTCGAGCTTTGCCGCGATGATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-187s21c1
Sequence:CCGGCACGACATCCTGGAGTATTTCCTCGAGGAAATACTCCAGGATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-494s21c1
Sequence:CCGGTGATGCTACGCTTCTTCTTTGCTCGAGCAAAGAAGAAGCGTAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-108s21c1
Sequence:CCGGCTACCTCTTCACCCTGTTCTTCTCGAGAAGAACAGGGTGAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080483
TMEM8C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 8C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-268s21c1
Sequence:CCGGGAACCCAAGAGGTCAACATTTCTCGAGAAATGTTGACCTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-376s21c1
Sequence:CCGGATCCTCATCATCGCGGCAAAGCTCGAGCTTTGCCGCGATGATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-187s21c1
Sequence:CCGGCACGACATCCTGGAGTATTTCCTCGAGGAAATACTCCAGGATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-494s21c1
Sequence:CCGGTGATGCTACGCTTCTTCTTTGCTCGAGCAAAGAAGAAGCGTAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-108s21c1
Sequence:CCGGCTACCTCTTCACCCTGTTCTTCTCGAGAAGAACAGGGTGAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080483
TMEM8C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 8C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-268s21c1
Sequence:CCGGGAACCCAAGAGGTCAACATTTCTCGAGAAATGTTGACCTCTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-376s21c1
Sequence:CCGGATCCTCATCATCGCGGCAAAGCTCGAGCTTTGCCGCGATGATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-187s21c1
Sequence:CCGGCACGACATCCTGGAGTATTTCCTCGAGGAAATACTCCAGGATGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-494s21c1
Sequence:CCGGTGATGCTACGCTTCTTCTTTGCTCGAGCAAAGAAGAAGCGTAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080483.1-108s21c1
Sequence:CCGGCTACCTCTTCACCCTGTTCTTCTCGAGAAGAACAGGGTGAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025376
TMEM8C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 8C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025376.1-883s1c1
Sequence:CCGGCCAAGGTACTTCCTATACTTTCTCGAGAAAGTATAGGAAGTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025376.1-550s1c1
Sequence:CCGGGAAGAAGATGAAAGAGAAGAACTCGAGTTCTTCTCTTTCATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025376.1-525s1c1
Sequence:CCGGCCCTCATCATTGCTGTAAAGTCTCGAGACTTTACAGCAATGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025376.1-882s1c1
Sequence:CCGGCCCAAGGTACTTCCTATACTTCTCGAGAAGTATAGGAAGTACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025376.1-647s1c1
Sequence:CCGGCTTCGATTCTTCTTTGAGGAACTCGAGTTCCTCAAAGAAGAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025376
TMEM8C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 8C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025376.1-883s1c1
Sequence:CCGGCCAAGGTACTTCCTATACTTTCTCGAGAAAGTATAGGAAGTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025376.1-550s1c1
Sequence:CCGGGAAGAAGATGAAAGAGAAGAACTCGAGTTCTTCTCTTTCATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025376.1-525s1c1
Sequence:CCGGCCCTCATCATTGCTGTAAAGTCTCGAGACTTTACAGCAATGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025376.1-882s1c1
Sequence:CCGGCCCAAGGTACTTCCTATACTTCTCGAGAAGTATAGGAAGTACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025376.1-647s1c1
Sequence:CCGGCTTCGATTCTTCTTTGAGGAACTCGAGTTCCTCAAAGAAGAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025376
TMEM8C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 8C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025376.1-883s1c1
Sequence:CCGGCCAAGGTACTTCCTATACTTTCTCGAGAAAGTATAGGAAGTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025376.1-550s1c1
Sequence:CCGGGAAGAAGATGAAAGAGAAGAACTCGAGTTCTTCTCTTTCATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025376.1-525s1c1
Sequence:CCGGCCCTCATCATTGCTGTAAAGTCTCGAGACTTTACAGCAATGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025376.1-882s1c1
Sequence:CCGGCCCAAGGTACTTCCTATACTTCTCGAGAAGTATAGGAAGTACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025376.1-647s1c1
Sequence:CCGGCTTCGATTCTTCTTTGAGGAACTCGAGTTCCTCAAAGAAGAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks