EMAIL THIS PAGE TO A FRIEND

TMEM91

transmembrane protein 91

Synonyms: DSPC3 IFITMD6
UniProtKB ID: Q6ZNR0, C9J9D1, C9JZ62, C9K046, Q6P434
Gene ID:
Mouse(320208) transmembrane protein 91
Rat(100359879) transmembrane protein 91
Zebrafish(100034583) transmembrane protein 91
dog(100682781) transmembrane protein 91
domestic cat(101087694) transmembrane protein 91
cow(100848860) transmembrane protein 91
sheep(101122049) transmembrane protein 91
domestic guinea pig(100731066) transmembrane protein 91
naked mole-rat(101705182) transmembrane protein 91
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042595 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042595 Rosetta Predictions human pricing
NM_001098821 Rosetta Predictions human pricing
NM_001098822 Rosetta Predictions human pricing
NM_001098823 Rosetta Predictions human pricing
NM_001098824 Rosetta Predictions human pricing
NM_001098825 Rosetta Predictions human pricing
NM_177102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310738 predicted 723
2 SASI_Hs02_00310739 predicted 718
3 SASI_Hs02_00310740 predicted 337
4 SASI_Hs02_00310741 predicted 94
5 SASI_Hs02_00310742 predicted 293
6 SASI_Hs02_00310743 predicted 187
7 SASI_Hs02_00310744 predicted 92
8 SASI_Hs02_00310745 predicted 796
9 SASI_Hs02_00310746 predicted 814
10 SASI_Hs02_00310747 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320054 predicted 450
2 SASI_Hs02_00320055 predicted 488
3 SASI_Hs02_00320056 predicted 454
4 SASI_Hs02_00320057 predicted 604
5 SASI_Hs02_00320058 predicted 356
6 SASI_Hs02_00320059 predicted 561
7 SASI_Hs02_00320060 predicted 912
8 SASI_Hs02_00320061 predicted 909
9 SASI_Hs02_00320062 predicted 872
10 SASI_Hs02_00320063 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320064 predicted 451
2 SASI_Hs02_00320065 predicted 490
3 SASI_Hs02_00320066 predicted 452
4 SASI_Hs02_00320067 predicted 596
5 SASI_Hs02_00320068 predicted 351
6 SASI_Hs02_00320069 predicted 556
7 SASI_Hs02_00320070 predicted 764
8 SASI_Hs02_00320071 predicted 758
9 SASI_Hs02_00320072 predicted 728
10 SASI_Hs02_00320073 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320074 predicted 453
2 SASI_Hs02_00320075 predicted 484
3 SASI_Hs02_00320076 predicted 458
4 SASI_Hs02_00320077 predicted 605
5 SASI_Hs02_00320078 predicted 354
6 SASI_Hs02_00320079 predicted 556
7 SASI_Hs02_00320080 predicted 746
8 SASI_Hs02_00320081 predicted 744
9 SASI_Hs02_00320082 predicted 682
10 SASI_Hs02_00320083 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320084 predicted 455
2 SASI_Hs02_00320085 predicted 486
3 SASI_Hs02_00320086 predicted 456
4 SASI_Hs02_00320087 predicted 605
5 SASI_Hs02_00320088 predicted 359
6 SASI_Hs02_00320089 predicted 557
7 SASI_Hs02_00320090 predicted 741
8 SASI_Hs02_00320091 predicted 740
9 SASI_Hs02_00320092 predicted 585
10 SASI_Hs02_00320093 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320094 predicted 413
2 SASI_Hs02_00320095 predicted 363
3 SASI_Hs02_00320096 predicted 260
4 SASI_Hs02_00320097 predicted 294
5 SASI_Hs02_00320098 predicted 493
6 SASI_Hs02_00320099 predicted 489
7 SASI_Hs02_00320100 predicted 396
8 SASI_Hs02_00320101 predicted 359
9 SASI_Hs02_00320102 predicted 490
10 SASI_Hs02_00320103 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168915 predicted 496
2 SASI_Mm01_00168916 predicted 255
3 SASI_Mm01_00168917 predicted 258
4 SASI_Mm01_00168918 predicted 401
5 SASI_Mm01_00168919 predicted 451
6 SASI_Mm01_00168920 predicted 436
7 SASI_Mm01_00168921 predicted 383
8 SASI_Mm01_00168922 predicted 356
9 SASI_Mm01_00168924 predicted 405
10 SASI_Mm02_00347096 predicted 438
11 SASI_Mm01_00168923 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042595
TMEM91 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 91
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-340s21c1
Sequence:CCGGGCAGCCGTCTTTCACCATTTCCTCGAGGAAATGGTGAAAGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-492s21c1
Sequence:CCGGTTTGGAATACATGCATGAATGCTCGAGCATTCATGCATGTATTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-390s21c1
Sequence:CCGGTTCTCCATGCTGTGTTGTTTCCTCGAGGAAACAACACAGCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-467s21c1
Sequence:CCGGCTATAGTAGGTGCTACGTATCCTCGAGGATACGTAGCACCTACTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042595.2-591s21c1
Sequence:CCGGACTGCCTCTACAGACCAACAACTCGAGTTGTTGGTCTGTAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042595
TMEM91 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 91
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-340s21c1
Sequence:CCGGGCAGCCGTCTTTCACCATTTCCTCGAGGAAATGGTGAAAGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-492s21c1
Sequence:CCGGTTTGGAATACATGCATGAATGCTCGAGCATTCATGCATGTATTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-390s21c1
Sequence:CCGGTTCTCCATGCTGTGTTGTTTCCTCGAGGAAACAACACAGCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-467s21c1
Sequence:CCGGCTATAGTAGGTGCTACGTATCCTCGAGGATACGTAGCACCTACTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042595.2-591s21c1
Sequence:CCGGACTGCCTCTACAGACCAACAACTCGAGTTGTTGGTCTGTAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042595
TMEM91 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 91
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-340s21c1
Sequence:CCGGGCAGCCGTCTTTCACCATTTCCTCGAGGAAATGGTGAAAGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-492s21c1
Sequence:CCGGTTTGGAATACATGCATGAATGCTCGAGCATTCATGCATGTATTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-390s21c1
Sequence:CCGGTTCTCCATGCTGTGTTGTTTCCTCGAGGAAACAACACAGCATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042595.2-467s21c1
Sequence:CCGGCTATAGTAGGTGCTACGTATCCTCGAGGATACGTAGCACCTACTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042595.2-591s21c1
Sequence:CCGGACTGCCTCTACAGACCAACAACTCGAGTTGTTGGTCTGTAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177102
TMEM91 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 91
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-258s21c1
Sequence:CCGGCCTTCCCAGAAACTGCCTTTGCTCGAGCAAAGGCAGTTTCTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-456s21c1
Sequence:CCGGTATTCTCTGTGCTGTGTTGTTCTCGAGAACAACACAGCACAGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-357s21c1
Sequence:CCGGCTGACTTTGAGGACACATTATCTCGAGATAATGTGTCCTCAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-505s21c1
Sequence:CCGGTCTGGCCCACAAGACCAACAACTCGAGTTGTTGGTCTTGTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-190s21c1
Sequence:CCGGACCCTTACTGCCAAGCATAACCTCGAGGTTATGCTTGGCAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177102.2-369s1c1
Sequence:CCGGGACACATTATCCAGTGACAGTCTCGAGACTGTCACTGGATAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177102.2-384s1c1
Sequence:CCGGGACAGTGACTCAGATGATGATCTCGAGATCATCATCTGAGTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177102
TMEM91 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 91
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-258s21c1
Sequence:CCGGCCTTCCCAGAAACTGCCTTTGCTCGAGCAAAGGCAGTTTCTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-456s21c1
Sequence:CCGGTATTCTCTGTGCTGTGTTGTTCTCGAGAACAACACAGCACAGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-357s21c1
Sequence:CCGGCTGACTTTGAGGACACATTATCTCGAGATAATGTGTCCTCAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-505s21c1
Sequence:CCGGTCTGGCCCACAAGACCAACAACTCGAGTTGTTGGTCTTGTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-190s21c1
Sequence:CCGGACCCTTACTGCCAAGCATAACCTCGAGGTTATGCTTGGCAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177102.2-369s1c1
Sequence:CCGGGACACATTATCCAGTGACAGTCTCGAGACTGTCACTGGATAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177102.2-384s1c1
Sequence:CCGGGACAGTGACTCAGATGATGATCTCGAGATCATCATCTGAGTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177102
TMEM91 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 91
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-258s21c1
Sequence:CCGGCCTTCCCAGAAACTGCCTTTGCTCGAGCAAAGGCAGTTTCTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-456s21c1
Sequence:CCGGTATTCTCTGTGCTGTGTTGTTCTCGAGAACAACACAGCACAGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-357s21c1
Sequence:CCGGCTGACTTTGAGGACACATTATCTCGAGATAATGTGTCCTCAAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-505s21c1
Sequence:CCGGTCTGGCCCACAAGACCAACAACTCGAGTTGTTGGTCTTGTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177102.3-190s21c1
Sequence:CCGGACCCTTACTGCCAAGCATAACCTCGAGGTTATGCTTGGCAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177102.2-369s1c1
Sequence:CCGGGACACATTATCCAGTGACAGTCTCGAGACTGTCACTGGATAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177102.2-384s1c1
Sequence:CCGGGACAGTGACTCAGATGATGATCTCGAGATCATCATCTGAGTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks