EMAIL THIS PAGE TO A FRIEND

TMEM92

transmembrane protein 92

UniProtKB ID: Q6UXU6, Q8NBF0
Gene ID:
Mouse(544806) transmembrane protein 92
Rat(690666) transmembrane protein 92
naked mole-rat(101709218) transmembrane protein 92
cow(507710) transmembrane protein 92
sheep(101107614) transmembrane protein 92
domestic cat(101091979) transmembrane protein 92
dog(609270) transmembrane protein 92
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035561 MISSION® esiRNA esiRNA human TMEM92 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153229 Rosetta Predictions human pricing
XM_001075148 Rosetta Predictions rat pricing
NM_001034896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067415 predicted 516
2 SASI_Hs01_00067416 predicted 254
3 SASI_Hs01_00067417 predicted 441
4 SASI_Hs01_00067418 predicted 193
5 SASI_Hs01_00067419 predicted 237
6 SASI_Hs01_00067420 predicted 980
7 SASI_Hs01_00067421 predicted 621
8 SASI_Hs02_00367093 predicted 973
9 SASI_Hs01_00067422 predicted 605
10 SASI_Hs01_00067424 predicted 506
11 SASI_Hs01_00067423 predicted 60
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348656 predicted 20
2 SASI_Rn02_00348657 predicted 181
3 SASI_Rn02_00348658 predicted 43
4 SASI_Rn02_00348659 predicted 96
5 SASI_Rn02_00348660 predicted 109
6 SASI_Rn02_00348661 predicted 306
7 SASI_Rn02_00348662 predicted 273
8 SASI_Rn02_00348663 predicted 66
9 SASI_Rn02_00348664 predicted 36
10 SASI_Rn02_00348665 predicted 124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069463 predicted 433
2 SASI_Mm01_00069464 predicted 386
3 SASI_Mm01_00069465 predicted 449
4 SASI_Mm01_00069467 predicted 448
5 SASI_Mm01_00069468 predicted 412
6 SASI_Mm01_00069469 predicted 977
7 SASI_Mm01_00069470 predicted 465
8 SASI_Mm01_00069471 predicted 430
9 SASI_Mm02_00289179 predicted 1003
10 SASI_Mm02_00289180 predicted 964
11 SASI_Mm01_00069462 predicted 329
12 SASI_Mm01_00069466 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153229
VALIDATED
TMEM92 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 92
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-452s1c1
Sequence:CCGGGCTTCAGGCCTGAAGAATATACTCGAGTATATTCTTCAGGCCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-450s1c1
Sequence:CCGGCAGCTTCAGGCCTGAAGAATACTCGAGTATTCTTCAGGCCTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-2485s1c1
Sequence:CCGGCCTGCTATGTAGGAAACACTACTCGAGTAGTGTTTCCTACATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153229.1-986s1c1
Sequence:CCGGCCTCACTGAATGTTACTGATTCTCGAGAATCAGTAACATTCAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153229.1-140s1c1
Sequence:CCGGGATTCAAATGCTGTGGTGACACTCGAGTGTCACCACAGCATTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153229.1-198s1c1
Sequence:CCGGGAGGATCTTCGTCATCATCTTCTCGAGAAGATGATGACGAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-385s21c1
Sequence:CCGGCCCTACAGTGAGGTGATTCTGCTCGAGCAGAATCACCTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153229.1-351s21c1
Sequence:CCGGGAGGGTCAGAGTATCCCTTTCCTCGAGGAAAGGGATACTCTGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-452s21c1
Sequence:CCGGGCTTCAGGCCTGAAGAATATACTCGAGTATATTCTTCAGGCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-2485s21c1
Sequence:CCGGCCTGCTATGTAGGAAACACTACTCGAGTAGTGTTTCCTACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-220s21c1
Sequence:CCGGCTGGTCATCCTGTCCGTCTTTCTCGAGAAAGACGGACAGGATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153229
VALIDATED
TMEM92 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 92
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-452s1c1
Sequence:CCGGGCTTCAGGCCTGAAGAATATACTCGAGTATATTCTTCAGGCCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-450s1c1
Sequence:CCGGCAGCTTCAGGCCTGAAGAATACTCGAGTATTCTTCAGGCCTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-2485s1c1
Sequence:CCGGCCTGCTATGTAGGAAACACTACTCGAGTAGTGTTTCCTACATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153229.1-986s1c1
Sequence:CCGGCCTCACTGAATGTTACTGATTCTCGAGAATCAGTAACATTCAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153229.1-140s1c1
Sequence:CCGGGATTCAAATGCTGTGGTGACACTCGAGTGTCACCACAGCATTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153229.1-198s1c1
Sequence:CCGGGAGGATCTTCGTCATCATCTTCTCGAGAAGATGATGACGAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-385s21c1
Sequence:CCGGCCCTACAGTGAGGTGATTCTGCTCGAGCAGAATCACCTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153229.1-351s21c1
Sequence:CCGGGAGGGTCAGAGTATCCCTTTCCTCGAGGAAAGGGATACTCTGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-452s21c1
Sequence:CCGGGCTTCAGGCCTGAAGAATATACTCGAGTATATTCTTCAGGCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-2485s21c1
Sequence:CCGGCCTGCTATGTAGGAAACACTACTCGAGTAGTGTTTCCTACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-220s21c1
Sequence:CCGGCTGGTCATCCTGTCCGTCTTTCTCGAGAAAGACGGACAGGATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153229
VALIDATED
TMEM92 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 92
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-452s1c1
Sequence:CCGGGCTTCAGGCCTGAAGAATATACTCGAGTATATTCTTCAGGCCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-450s1c1
Sequence:CCGGCAGCTTCAGGCCTGAAGAATACTCGAGTATTCTTCAGGCCTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153229.1-2485s1c1
Sequence:CCGGCCTGCTATGTAGGAAACACTACTCGAGTAGTGTTTCCTACATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153229.1-986s1c1
Sequence:CCGGCCTCACTGAATGTTACTGATTCTCGAGAATCAGTAACATTCAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153229.1-140s1c1
Sequence:CCGGGATTCAAATGCTGTGGTGACACTCGAGTGTCACCACAGCATTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153229.1-198s1c1
Sequence:CCGGGAGGATCTTCGTCATCATCTTCTCGAGAAGATGATGACGAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-385s21c1
Sequence:CCGGCCCTACAGTGAGGTGATTCTGCTCGAGCAGAATCACCTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153229.1-351s21c1
Sequence:CCGGGAGGGTCAGAGTATCCCTTTCCTCGAGGAAAGGGATACTCTGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-452s21c1
Sequence:CCGGGCTTCAGGCCTGAAGAATATACTCGAGTATATTCTTCAGGCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-2485s21c1
Sequence:CCGGCCTGCTATGTAGGAAACACTACTCGAGTAGTGTTTCCTACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_153229.1-220s21c1
Sequence:CCGGCTGGTCATCCTGTCCGTCTTTCTCGAGAAAGACGGACAGGATGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034896
TMEM92 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 92
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034896.2-1824s21c1
Sequence:CCGGACAGGGATTCTGGCTAGATTTCTCGAGAAATCTAGCCAGAATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-402s21c1
Sequence:CCGGTCAAGGAATGCTGCCCGGAAACTCGAGTTTCCGGGCAGCATTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-465s21c1
Sequence:CCGGTCATCCTGGCATGCATCATTTCTCGAGAAATGATGCATGCCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-508s21c1
Sequence:CCGGCCTAGTTGTTCAGATGACACCCTCGAGGGTGTCATCTGAACAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-440s21c1
Sequence:CCGGGCAAATGACCGCTTTAGGTTCCTCGAGGAACCTAAAGCGGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034896
TMEM92 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 92
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034896.2-1824s21c1
Sequence:CCGGACAGGGATTCTGGCTAGATTTCTCGAGAAATCTAGCCAGAATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-402s21c1
Sequence:CCGGTCAAGGAATGCTGCCCGGAAACTCGAGTTTCCGGGCAGCATTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-465s21c1
Sequence:CCGGTCATCCTGGCATGCATCATTTCTCGAGAAATGATGCATGCCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-508s21c1
Sequence:CCGGCCTAGTTGTTCAGATGACACCCTCGAGGGTGTCATCTGAACAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-440s21c1
Sequence:CCGGGCAAATGACCGCTTTAGGTTCCTCGAGGAACCTAAAGCGGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034896
TMEM92 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 92
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034896.2-1824s21c1
Sequence:CCGGACAGGGATTCTGGCTAGATTTCTCGAGAAATCTAGCCAGAATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-402s21c1
Sequence:CCGGTCAAGGAATGCTGCCCGGAAACTCGAGTTTCCGGGCAGCATTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-465s21c1
Sequence:CCGGTCATCCTGGCATGCATCATTTCTCGAGAAATGATGCATGCCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-508s21c1
Sequence:CCGGCCTAGTTGTTCAGATGACACCCTCGAGGGTGTCATCTGAACAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034896.2-440s21c1
Sequence:CCGGGCAAATGACCGCTTTAGGTTCCTCGAGGAACCTAAAGCGGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks