EMAIL THIS PAGE TO A FRIEND

TMEM95

transmembrane protein 95

Synonyms: UNQ9390
UniProtKB ID: Q3KNT9, B7WPI7, Q6UXT3, Q8IW68
Gene ID:
Mouse(100503361) transmembrane protein 95
Rat(691982) transmembrane protein 95
dog(607773) transmembrane protein 95
domestic cat(101097028) transmembrane protein 95
cow(614631) transmembrane protein 95
sheep(101118625) transmembrane protein 95
domestic guinea pig(100735902) transmembrane protein 95
naked mole-rat(101718840) transmembrane protein 95
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198154 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198154 Rosetta Predictions human pricing
NM_001134799 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228064 predicted 231
2 SASI_Hs01_00228065 predicted 210
3 SASI_Hs01_00228066 predicted 678
4 SASI_Hs01_00228069 predicted 201
5 SASI_Hs01_00228072 predicted 516
6 SASI_Hs01_00228073 predicted 706
7 SASI_Hs02_00371689 predicted 460
8 SASI_Hs02_00371690 predicted 240
9 SASI_Hs02_00371691 predicted 392
10 SASI_Hs02_00371692 predicted 772
11 SASI_Hs01_00228067 predicted 235
12 SASI_Hs01_00228068 predicted 260
13 SASI_Hs01_00228070 predicted 845
14 SASI_Hs01_00228071 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258574 predicted 242
2 SASI_Rn02_00258575 predicted 234
3 SASI_Rn02_00258576 predicted 200
4 SASI_Rn02_00258577 predicted 310
5 SASI_Rn02_00258578 predicted 198
6 SASI_Rn02_00258579 predicted 320
7 SASI_Rn02_00258580 predicted 205
8 SASI_Rn02_00258581 predicted 208
9 SASI_Rn02_00258582 predicted 319
10 SASI_Rn02_00258583 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198154
TMEM95 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 95
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-237s21c1
Sequence:CCGGAGTCCTGAGGGTCATGGAAATCTCGAGATTTCCATGACCCTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198154.1-718s21c1
Sequence:CCGGTGCTTCTGGTTGGTGAGATAACTCGAGTTATCTCACCAACCAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-456s21c1
Sequence:CCGGCCCAGGAAGTCAGGATCTTTGCTCGAGCAAAGATCCTGACTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-270s21c1
Sequence:CCGGCTCCTCACTCCCTTCATATTGCTCGAGCAATATGAAGGGAGTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-197s21c1
Sequence:CCGGATGAGGTGTCCATGAACAAAGCTCGAGCTTTGTTCATGGACACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198154
TMEM95 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 95
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-237s21c1
Sequence:CCGGAGTCCTGAGGGTCATGGAAATCTCGAGATTTCCATGACCCTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198154.1-718s21c1
Sequence:CCGGTGCTTCTGGTTGGTGAGATAACTCGAGTTATCTCACCAACCAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-456s21c1
Sequence:CCGGCCCAGGAAGTCAGGATCTTTGCTCGAGCAAAGATCCTGACTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-270s21c1
Sequence:CCGGCTCCTCACTCCCTTCATATTGCTCGAGCAATATGAAGGGAGTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-197s21c1
Sequence:CCGGATGAGGTGTCCATGAACAAAGCTCGAGCTTTGTTCATGGACACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198154
TMEM95 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 95
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-237s21c1
Sequence:CCGGAGTCCTGAGGGTCATGGAAATCTCGAGATTTCCATGACCCTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198154.1-718s21c1
Sequence:CCGGTGCTTCTGGTTGGTGAGATAACTCGAGTTATCTCACCAACCAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-456s21c1
Sequence:CCGGCCCAGGAAGTCAGGATCTTTGCTCGAGCAAAGATCCTGACTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-270s21c1
Sequence:CCGGCTCCTCACTCCCTTCATATTGCTCGAGCAATATGAAGGGAGTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198154.1-197s21c1
Sequence:CCGGATGAGGTGTCCATGAACAAAGCTCGAGCTTTGTTCATGGACACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks