EMAIL THIS PAGE TO A FRIEND

TMEM97

transmembrane protein 97

Synonyms: MAC30
UniProtKB ID: Q5BJF2, B4DS02, Q07823
Gene ID:
Human(27346) Summary: TMEM97 is a conserved integral membrane protein that plays a role in controlling cellular cholesterol levels (Bartz et al., 2009 [PubMed 19583955]
Mouse(69071) transmembrane protein 97
Rat(303330) transmembrane protein 97
naked mole-rat(101702806) transmembrane protein 97
domestic guinea pig(100728802) transmembrane protein 97
cow(511378) transmembrane protein 97
sheep(101103331) transmembrane protein 97
chicken(417670) transmembrane protein 97
domestic cat(101080494) transmembrane protein 97
dog(610900) transmembrane protein 97
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044795 Anti-TMEM97 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014573 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU166981 MISSION® esiRNA esiRNA targeting mouse Tmem97 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014573 Rosetta Predictions human pricing
NM_001008334 Rosetta Predictions rat pricing
NM_133706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345840 predicted 271
2 SASI_Hs02_00345841 predicted 249
3 SASI_Hs02_00345842 predicted 391
4 SASI_Hs02_00345843 predicted 290
5 SASI_Hs02_00345844 predicted 298
6 SASI_Hs02_00345845 predicted 369
7 SASI_Hs01_00058812 predicted 593
8 SASI_Hs01_00058813 predicted 563
9 SASI_Hs01_00058819 predicted 489
10 SASI_Hs02_00345846 predicted 546
11 SASI_Hs01_00058811 predicted 725
12 SASI_Hs01_00058814 predicted 819
13 SASI_Hs01_00058815 predicted 557
14 SASI_Hs01_00058816 predicted 723
15 SASI_Hs01_00058817 predicted 772
16 SASI_Hs01_00058818 predicted 770
17 SASI_Hs01_00058820 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122267 predicted 884
2 SASI_Rn01_00122268 predicted 363
3 SASI_Rn01_00122269 predicted 759
4 SASI_Rn02_00199078 predicted 747
5 SASI_Rn01_00122271 predicted 356
6 SASI_Rn01_00122272 predicted 366
7 SASI_Rn02_00199079 predicted 512
8 SASI_Rn01_00122273 predicted 401
9 SASI_Rn01_00122274 predicted 785
10 SASI_Rn01_00122276 predicted 262
11 SASI_Rn01_00122270 predicted 212
12 SASI_Rn01_00122275 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338675 predicted 1041
2 SASI_Mm01_00097298 predicted 440
3 SASI_Mm01_00097299 predicted 886
4 SASI_Mm01_00097301 predicted 991
5 SASI_Mm01_00097302 predicted 1031
6 SASI_Mm01_00097303 predicted 431
7 SASI_Mm01_00097304 predicted 378
8 SASI_Mm01_00097305 predicted 332
9 SASI_Mm01_00097306 predicted 464
10 SASI_Mm02_00338676 predicted 1001
11 SASI_Mm01_00097297 predicted 429
12 SASI_Mm01_00097300 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133706
VALIDATED
TMEM97 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 97
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-395s21c1
Sequence:CCGGGCTCACACCATAACGACTTTACTCGAGTAAAGTCGTTATGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-459s21c1
Sequence:CCGGCCGTTGCTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-332s21c1
Sequence:CCGGGCGGCATATGCCTTCTTCAAACTCGAGTTTGAAGAAGGCATATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133706.2-898s21c1
Sequence:CCGGCGACCTTGATAGTCAACAAATCTCGAGATTTGTTGACTATCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-332s1c1
Sequence:CCGGGCGGCATATGCCTTCTTCAAACTCGAGTTTGAAGAAGGCATATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-395s1c1
Sequence:CCGGGCTCACACCATAACGACTTTACTCGAGTAAAGTCGTTATGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-459s1c1
Sequence:CCGGCCGTTGCTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-898s1c1
Sequence:CCGGCGACCTTGATAGTCAACAAATCTCGAGATTTGTTGACTATCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133706
VALIDATED
TMEM97 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 97
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-395s21c1
Sequence:CCGGGCTCACACCATAACGACTTTACTCGAGTAAAGTCGTTATGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-459s21c1
Sequence:CCGGCCGTTGCTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-332s21c1
Sequence:CCGGGCGGCATATGCCTTCTTCAAACTCGAGTTTGAAGAAGGCATATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133706.2-898s21c1
Sequence:CCGGCGACCTTGATAGTCAACAAATCTCGAGATTTGTTGACTATCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-332s1c1
Sequence:CCGGGCGGCATATGCCTTCTTCAAACTCGAGTTTGAAGAAGGCATATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-395s1c1
Sequence:CCGGGCTCACACCATAACGACTTTACTCGAGTAAAGTCGTTATGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-459s1c1
Sequence:CCGGCCGTTGCTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-898s1c1
Sequence:CCGGCGACCTTGATAGTCAACAAATCTCGAGATTTGTTGACTATCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133706
VALIDATED
TMEM97 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 97
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-395s21c1
Sequence:CCGGGCTCACACCATAACGACTTTACTCGAGTAAAGTCGTTATGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-459s21c1
Sequence:CCGGCCGTTGCTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133706.2-332s21c1
Sequence:CCGGGCGGCATATGCCTTCTTCAAACTCGAGTTTGAAGAAGGCATATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133706.2-898s21c1
Sequence:CCGGCGACCTTGATAGTCAACAAATCTCGAGATTTGTTGACTATCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-332s1c1
Sequence:CCGGGCGGCATATGCCTTCTTCAAACTCGAGTTTGAAGAAGGCATATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-395s1c1
Sequence:CCGGGCTCACACCATAACGACTTTACTCGAGTAAAGTCGTTATGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-459s1c1
Sequence:CCGGCCGTTGCTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133706.1-898s1c1
Sequence:CCGGCGACCTTGATAGTCAACAAATCTCGAGATTTGTTGACTATCAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014573
TMEM97 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 97
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014573.1-1938s1c1
Sequence:CCGGGCTTGGCATTCCATCAGCTTTCTCGAGAAAGCTGATGGAATGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-647s1c1
Sequence:CCGGCCCTACTACAAGTATGAAGAGCTCGAGCTCTTCATACTTGTAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014573.1-1319s1c1
Sequence:CCGGGCTAAAGAACATGGCCTGTTTCTCGAGAAACAGGCCATGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-557s1c1
Sequence:CCGGGAGACTTTGCATGAACGGTTACTCGAGTAACCGTTCATGCAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-548s1c1
Sequence:CCGGCAAAGACCTGAGACTTTGCATCTCGAGATGCAAAGTCTCAGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-565s1c1
Sequence:CCGGGCATGAACGGTTAACCCTTGTCTCGAGACAAGGGTTAACCGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-523s1c1
Sequence:CCGGCTCCAAAGCCAGTGGTTTCAACTCGAGTTGAAACCACTGGCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-515s1c1
Sequence:CCGGGAGGATTTCTCCAAAGCCAGTCTCGAGACTGGCTTTGGAGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-531s1c1
Sequence:CCGGCCAGTGGTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014573
TMEM97 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 97
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014573.1-1938s1c1
Sequence:CCGGGCTTGGCATTCCATCAGCTTTCTCGAGAAAGCTGATGGAATGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-647s1c1
Sequence:CCGGCCCTACTACAAGTATGAAGAGCTCGAGCTCTTCATACTTGTAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014573.1-1319s1c1
Sequence:CCGGGCTAAAGAACATGGCCTGTTTCTCGAGAAACAGGCCATGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-557s1c1
Sequence:CCGGGAGACTTTGCATGAACGGTTACTCGAGTAACCGTTCATGCAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-548s1c1
Sequence:CCGGCAAAGACCTGAGACTTTGCATCTCGAGATGCAAAGTCTCAGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-565s1c1
Sequence:CCGGGCATGAACGGTTAACCCTTGTCTCGAGACAAGGGTTAACCGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-523s1c1
Sequence:CCGGCTCCAAAGCCAGTGGTTTCAACTCGAGTTGAAACCACTGGCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-515s1c1
Sequence:CCGGGAGGATTTCTCCAAAGCCAGTCTCGAGACTGGCTTTGGAGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-531s1c1
Sequence:CCGGCCAGTGGTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014573
TMEM97 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 97
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014573.1-1938s1c1
Sequence:CCGGGCTTGGCATTCCATCAGCTTTCTCGAGAAAGCTGATGGAATGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-647s1c1
Sequence:CCGGCCCTACTACAAGTATGAAGAGCTCGAGCTCTTCATACTTGTAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014573.1-1319s1c1
Sequence:CCGGGCTAAAGAACATGGCCTGTTTCTCGAGAAACAGGCCATGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-557s1c1
Sequence:CCGGGAGACTTTGCATGAACGGTTACTCGAGTAACCGTTCATGCAAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-548s1c1
Sequence:CCGGCAAAGACCTGAGACTTTGCATCTCGAGATGCAAAGTCTCAGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-565s1c1
Sequence:CCGGGCATGAACGGTTAACCCTTGTCTCGAGACAAGGGTTAACCGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014573.1-523s1c1
Sequence:CCGGCTCCAAAGCCAGTGGTTTCAACTCGAGTTGAAACCACTGGCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-515s1c1
Sequence:CCGGGAGGATTTCTCCAAAGCCAGTCTCGAGACTGGCTTTGGAGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014573.1-531s1c1
Sequence:CCGGCCAGTGGTTTCAAGGGACAAACTCGAGTTTGTCCCTTGAAACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks