EMAIL THIS PAGE TO A FRIEND

TMEM98

transmembrane protein 98

UniProtKB ID: Q9Y2Y6, E1P631, Q9UFK2
Gene ID:
Mouse(103743) transmembrane protein 98
Rat(303356) transmembrane protein 98
dog(612961) transmembrane protein 98
domestic cat(101095697) transmembrane protein 98
cow(513445) transmembrane protein 98
sheep(101120587) transmembrane protein 98
domestic guinea pig(100717830) transmembrane protein 98
naked mole-rat(101726270) transmembrane protein 98
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015544 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033504 Rosetta Predictions human pricing
NM_015544 Rosetta Predictions human pricing
NM_001007672 Rosetta Predictions rat pricing
NM_029537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213115 predicted 611
2 SASI_Hs01_00213118 predicted 750
3 SASI_Hs01_00213120 predicted 549
4 SASI_Hs01_00213121 predicted 742
5 SASI_Hs02_00308021 predicted 617
6 SASI_Hs02_00308022 predicted 550
7 SASI_Hs02_00308023 predicted 1107
8 SASI_Hs02_00308024 predicted 627
9 SASI_Hs01_00213113 predicted 691
10 SASI_Hs02_00308025 predicted 602
11 SASI_Hs01_00213114 predicted 681
12 SASI_Hs01_00213116 predicted 1060
13 SASI_Hs01_00213117 predicted 989
14 SASI_Hs01_00213119 predicted 992
15 SASI_Hs01_00213122 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084151 predicted 693
2 SASI_Hs01_00084154 predicted 819
3 SASI_Hs01_00084156 predicted 622
4 SASI_Hs01_00084157 predicted 816
5 SASI_Hs02_00348071 predicted 697
6 SASI_Hs02_00348072 predicted 627
7 SASI_Hs02_00348073 predicted 1184
8 SASI_Hs02_00348074 predicted 708
9 SASI_Hs01_00084149 predicted 763
10 SASI_Hs02_00348075 predicted 679
11 SASI_Hs01_00084150 predicted 763
12 SASI_Hs01_00084152 predicted 1143
13 SASI_Hs01_00084153 predicted 1068
14 SASI_Hs01_00084155 predicted 1070
15 SASI_Hs01_00084158 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085912 predicted 294
2 SASI_Rn02_00198803 predicted 1094
3 SASI_Rn01_00085913 predicted 355
4 SASI_Rn01_00085914 predicted 793
5 SASI_Rn01_00085915 predicted 238
6 SASI_Rn01_00085916 predicted 965
7 SASI_Rn01_00085917 predicted 840
8 SASI_Rn01_00085919 predicted 309
9 SASI_Rn01_00085920 predicted 1118
10 SASI_Rn01_00085921 predicted 305
11 SASI_Rn01_00085918 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159985 predicted 931
2 SASI_Mm01_00159986 predicted 764
3 SASI_Mm01_00159987 predicted 815
4 SASI_Mm01_00159988 predicted 1109
5 SASI_Mm01_00159989 predicted 333
6 SASI_Mm01_00159990 predicted 198
7 SASI_Mm01_00159991 predicted 824
8 SASI_Mm01_00159992 predicted 382
9 SASI_Mm01_00159993 predicted 974
10 SASI_Mm01_00159994 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029537
VALIDATED
TMEM98 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 98
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029537.1-593s1c1
Sequence:CCGGCGTTAGTCACTTGGTGCTAGTCTCGAGACTAGCACCAAGTGACTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029537.1-383s1c1
Sequence:CCGGCGCCATCTTGAAGATTTGTCACTCGAGTGACAAATCTTCAAGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-484s21c1
Sequence:CCGGTTGTGGTGGCCAAACGGATTACTCGAGTAATCCGTTTGGCCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-760s21c1
Sequence:CCGGAGGAACAGTCGGCCATTTAATCTCGAGATTAAATGGCCGACTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-201s21c1
Sequence:CCGGCGAGACCTACTACAGCGTTATCTCGAGATAACGCTGTAGTAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-1139s21c1
Sequence:CCGGTAAGTGGCTAGGTCGAGATAGCTCGAGCTATCTCGACCTAGCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-516s21c1
Sequence:CCGGGACGACGTCGTGAAGTCAATGCTCGAGCATTGACTTCACGACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029537
VALIDATED
TMEM98 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 98
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029537.1-593s1c1
Sequence:CCGGCGTTAGTCACTTGGTGCTAGTCTCGAGACTAGCACCAAGTGACTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029537.1-383s1c1
Sequence:CCGGCGCCATCTTGAAGATTTGTCACTCGAGTGACAAATCTTCAAGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-484s21c1
Sequence:CCGGTTGTGGTGGCCAAACGGATTACTCGAGTAATCCGTTTGGCCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-760s21c1
Sequence:CCGGAGGAACAGTCGGCCATTTAATCTCGAGATTAAATGGCCGACTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-201s21c1
Sequence:CCGGCGAGACCTACTACAGCGTTATCTCGAGATAACGCTGTAGTAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-1139s21c1
Sequence:CCGGTAAGTGGCTAGGTCGAGATAGCTCGAGCTATCTCGACCTAGCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-516s21c1
Sequence:CCGGGACGACGTCGTGAAGTCAATGCTCGAGCATTGACTTCACGACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029537
VALIDATED
TMEM98 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 98
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029537.1-593s1c1
Sequence:CCGGCGTTAGTCACTTGGTGCTAGTCTCGAGACTAGCACCAAGTGACTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029537.1-383s1c1
Sequence:CCGGCGCCATCTTGAAGATTTGTCACTCGAGTGACAAATCTTCAAGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-484s21c1
Sequence:CCGGTTGTGGTGGCCAAACGGATTACTCGAGTAATCCGTTTGGCCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-760s21c1
Sequence:CCGGAGGAACAGTCGGCCATTTAATCTCGAGATTAAATGGCCGACTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-201s21c1
Sequence:CCGGCGAGACCTACTACAGCGTTATCTCGAGATAACGCTGTAGTAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-1139s21c1
Sequence:CCGGTAAGTGGCTAGGTCGAGATAGCTCGAGCTATCTCGACCTAGCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029537.1-516s21c1
Sequence:CCGGGACGACGTCGTGAAGTCAATGCTCGAGCATTGACTTCACGACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015544
VALIDATED
TMEM98 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 98
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-482s1c1
Sequence:CCGGCCACTGCATTGCCATCTTGAACTCGAGTTCAAGATGGCAATGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-245s1c1
Sequence:CCGGCACCATCTTTCTGGCTTCGTTCTCGAGAACGAAGCCAGAAAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-324s1c1
Sequence:CCGGCGCTATGATTCTAAGCCCATTCTCGAGAATGGGCTTAGAATCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-1119s21c1
Sequence:CCGGCAGGAGCAGTCTGCAATTTAGCTCGAGCTAAATTGCAGACTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-826s21c1
Sequence:CCGGCCAGTGTCAGCGACATCATTGCTCGAGCAATGATGTCGCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-1072s21c1
Sequence:CCGGTAGCTTCTGAGCCAGATAAAGCTCGAGCTTTATCTGGCTCAGAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015544.2-1252s21c1
Sequence:CCGGCAGCTGTGTGTGCATAGTAAACTCGAGTTTACTATGCACACACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-645s21c1
Sequence:CCGGGAACTGGACGATGTCGTTATCCTCGAGGATAACGACATCGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015544
VALIDATED
TMEM98 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 98
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-482s1c1
Sequence:CCGGCCACTGCATTGCCATCTTGAACTCGAGTTCAAGATGGCAATGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-245s1c1
Sequence:CCGGCACCATCTTTCTGGCTTCGTTCTCGAGAACGAAGCCAGAAAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-324s1c1
Sequence:CCGGCGCTATGATTCTAAGCCCATTCTCGAGAATGGGCTTAGAATCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-1119s21c1
Sequence:CCGGCAGGAGCAGTCTGCAATTTAGCTCGAGCTAAATTGCAGACTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-826s21c1
Sequence:CCGGCCAGTGTCAGCGACATCATTGCTCGAGCAATGATGTCGCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-1072s21c1
Sequence:CCGGTAGCTTCTGAGCCAGATAAAGCTCGAGCTTTATCTGGCTCAGAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015544.2-1252s21c1
Sequence:CCGGCAGCTGTGTGTGCATAGTAAACTCGAGTTTACTATGCACACACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-645s21c1
Sequence:CCGGGAACTGGACGATGTCGTTATCCTCGAGGATAACGACATCGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015544
VALIDATED
TMEM98 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 98
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-482s1c1
Sequence:CCGGCCACTGCATTGCCATCTTGAACTCGAGTTCAAGATGGCAATGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-245s1c1
Sequence:CCGGCACCATCTTTCTGGCTTCGTTCTCGAGAACGAAGCCAGAAAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015544.1-324s1c1
Sequence:CCGGCGCTATGATTCTAAGCCCATTCTCGAGAATGGGCTTAGAATCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-1119s21c1
Sequence:CCGGCAGGAGCAGTCTGCAATTTAGCTCGAGCTAAATTGCAGACTGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-826s21c1
Sequence:CCGGCCAGTGTCAGCGACATCATTGCTCGAGCAATGATGTCGCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-1072s21c1
Sequence:CCGGTAGCTTCTGAGCCAGATAAAGCTCGAGCTTTATCTGGCTCAGAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015544.2-1252s21c1
Sequence:CCGGCAGCTGTGTGTGCATAGTAAACTCGAGTTTACTATGCACACACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015544.2-645s21c1
Sequence:CCGGGAACTGGACGATGTCGTTATCCTCGAGGATAACGACATCGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks