EMAIL THIS PAGE TO A FRIEND

TMEM99

transmembrane protein 99

Species: Human TMEM99(147184)
UniProtKB ID: Q8N816, B4DQ34, Q96BP9
Gene ID:
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145274 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039791 MISSION® esiRNA esiRNA human TMEM99 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145274 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139699 predicted 437
2 SASI_Hs02_00365148 predicted 693
3 SASI_Hs02_00365149 predicted 679
4 SASI_Hs01_00139703 predicted 451
5 SASI_Hs02_00365150 predicted 670
6 SASI_Hs01_00139704 predicted 343
7 SASI_Hs02_00365151 predicted 684
8 SASI_Hs02_00365152 predicted 359
9 SASI_Hs01_00139707 predicted 400
10 SASI_Hs01_00139708 predicted 538
11 SASI_Hs01_00139700 predicted 440
12 SASI_Hs01_00139701 predicted 605
13 SASI_Hs01_00139702 predicted 436
14 SASI_Hs01_00139705 predicted 434
15 SASI_Hs01_00139706 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145274
TMEM99 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 99
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-1064s21c1
Sequence:CCGGTCTACGTTTACCTCAACATAACTCGAGTTATGTTGAGGTAAACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145274.2-1697s21c1
Sequence:CCGGTGATTGTTTCTGAGGTAATTCCTCGAGGAATTACCTCAGAAACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-894s21c1
Sequence:CCGGTCTGCTTAATATTGGGTATTTCTCGAGAAATACCCAATATTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-989s21c1
Sequence:CCGGTTATGGCAAAGCCTCATATTACTCGAGTAATATGAGGCTTTGCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-941s21c1
Sequence:CCGGATAGGCTTACCTTACATTAAACTCGAGTTTAATGTAAGGTAAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-430s1c1
Sequence:CCGGCTGCTCCCTTCCTCAAGTATTCTCGAGAATACTTGAGGAAGGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-569s1c1
Sequence:CCGGCGACTTCTTCCTTGTCTCCTTCTCGAGAAGGAGACAAGGAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-689s1c1
Sequence:CCGGGCATTCTTACCAGAGGCCATTCTCGAGAATGGCCTCTGGTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145274
TMEM99 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 99
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-1064s21c1
Sequence:CCGGTCTACGTTTACCTCAACATAACTCGAGTTATGTTGAGGTAAACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145274.2-1697s21c1
Sequence:CCGGTGATTGTTTCTGAGGTAATTCCTCGAGGAATTACCTCAGAAACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-894s21c1
Sequence:CCGGTCTGCTTAATATTGGGTATTTCTCGAGAAATACCCAATATTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-989s21c1
Sequence:CCGGTTATGGCAAAGCCTCATATTACTCGAGTAATATGAGGCTTTGCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-941s21c1
Sequence:CCGGATAGGCTTACCTTACATTAAACTCGAGTTTAATGTAAGGTAAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-430s1c1
Sequence:CCGGCTGCTCCCTTCCTCAAGTATTCTCGAGAATACTTGAGGAAGGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-569s1c1
Sequence:CCGGCGACTTCTTCCTTGTCTCCTTCTCGAGAAGGAGACAAGGAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-689s1c1
Sequence:CCGGGCATTCTTACCAGAGGCCATTCTCGAGAATGGCCTCTGGTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145274
TMEM99 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 99
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-1064s21c1
Sequence:CCGGTCTACGTTTACCTCAACATAACTCGAGTTATGTTGAGGTAAACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145274.2-1697s21c1
Sequence:CCGGTGATTGTTTCTGAGGTAATTCCTCGAGGAATTACCTCAGAAACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-894s21c1
Sequence:CCGGTCTGCTTAATATTGGGTATTTCTCGAGAAATACCCAATATTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-989s21c1
Sequence:CCGGTTATGGCAAAGCCTCATATTACTCGAGTAATATGAGGCTTTGCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145274.2-941s21c1
Sequence:CCGGATAGGCTTACCTTACATTAAACTCGAGTTTAATGTAAGGTAAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-430s1c1
Sequence:CCGGCTGCTCCCTTCCTCAAGTATTCTCGAGAATACTTGAGGAAGGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-569s1c1
Sequence:CCGGCGACTTCTTCCTTGTCTCCTTCTCGAGAAGGAGACAAGGAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145274.1-689s1c1
Sequence:CCGGGCATTCTTACCAGAGGCCATTCTCGAGAATGGCCTCTGGTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks