EMAIL THIS PAGE TO A FRIEND

TMEM9

transmembrane protein 9

Synonyms: TMEM9A
UniProtKB ID: Q9P0T7, B1ALM6, Q96NQ9, Q9BQF5
Gene ID:
Mouse(66241) transmembrane protein 9
Rat(289046) transmembrane protein 9
naked mole-rat(101725356) transmembrane protein 9
domestic guinea pig(100734461) transmembrane protein 9
cow(100125921) transmembrane protein 9
sheep(101103661) transmembrane protein 9
Zebrafish(334151) transmembrane protein 9
domestic cat(101095944) transmembrane protein 9
chicken(421157) transmembrane protein 9
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016456 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016456 Rosetta Predictions human pricing
NM_001105953 Rosetta Predictions rat pricing
NM_025439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126744 predicted 372
2 SASI_Hs01_00126745 predicted 474
3 SASI_Hs01_00126746 predicted 859
4 SASI_Hs02_00349493 predicted 242
5 SASI_Hs01_00126747 predicted 852
6 SASI_Hs01_00126748 predicted 478
7 SASI_Hs01_00126749 predicted 329
8 SASI_Hs01_00126750 predicted 810
9 SASI_Hs01_00126751 predicted 465
10 SASI_Hs01_00126752 predicted 509
11 SASI_Hs01_00126753 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214172 predicted 296
2 SASI_Rn02_00214173 predicted 335
3 SASI_Rn02_00214174 predicted 748
4 SASI_Rn02_00214175 predicted 602
5 SASI_Rn02_00214176 predicted 423
6 SASI_Rn02_00214177 predicted 777
7 SASI_Rn02_00214178 predicted 610
8 SASI_Rn02_00214179 predicted 872
9 SASI_Rn02_00214180 predicted 334
10 SASI_Rn02_00214181 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166104 predicted 469
2 SASI_Mm01_00166105 predicted 310
3 SASI_Mm01_00166106 predicted 741
4 SASI_Mm01_00166107 predicted 749
5 SASI_Mm01_00166108 predicted 719
6 SASI_Mm01_00166109 predicted 282
7 SASI_Mm01_00166110 predicted 765
8 SASI_Mm01_00166111 predicted 911
9 SASI_Mm01_00166112 predicted 846
10 SASI_Mm01_00166113 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025439
VALIDATED
TMEM9 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025439.2-337s1c1
Sequence:CCGGCAAGGTCATTATTGTCATCTACTCGAGTAGATGACAATAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025439.2-144s1c1
Sequence:CCGGCTGAAGATATCCGGTGCAAATCTCGAGATTTGCACCGGATATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-144s21c1
Sequence:CCGGCTGAAGATATCCGGTGCAAATCTCGAGATTTGCACCGGATATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-438s21c1
Sequence:CCGGATACTGAGCAGCTGCACAATGCTCGAGCATTGTGCAGCTGCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-708s21c1
Sequence:CCGGTCAAATGCCCATGGCGTTTATCTCGAGATAAACGCCATGGGCATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-183s21c1
Sequence:CCGGGAAACATCAGCGGGCACATTTCTCGAGAAATGTGCCCGCTGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-328s21c1
Sequence:CCGGCACAACCATCAAGGTCATTATCTCGAGATAATGACCTTGATGGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025439
VALIDATED
TMEM9 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025439.2-337s1c1
Sequence:CCGGCAAGGTCATTATTGTCATCTACTCGAGTAGATGACAATAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025439.2-144s1c1
Sequence:CCGGCTGAAGATATCCGGTGCAAATCTCGAGATTTGCACCGGATATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-144s21c1
Sequence:CCGGCTGAAGATATCCGGTGCAAATCTCGAGATTTGCACCGGATATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-438s21c1
Sequence:CCGGATACTGAGCAGCTGCACAATGCTCGAGCATTGTGCAGCTGCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-708s21c1
Sequence:CCGGTCAAATGCCCATGGCGTTTATCTCGAGATAAACGCCATGGGCATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-183s21c1
Sequence:CCGGGAAACATCAGCGGGCACATTTCTCGAGAAATGTGCCCGCTGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-328s21c1
Sequence:CCGGCACAACCATCAAGGTCATTATCTCGAGATAATGACCTTGATGGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025439
VALIDATED
TMEM9 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025439.2-337s1c1
Sequence:CCGGCAAGGTCATTATTGTCATCTACTCGAGTAGATGACAATAATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025439.2-144s1c1
Sequence:CCGGCTGAAGATATCCGGTGCAAATCTCGAGATTTGCACCGGATATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-144s21c1
Sequence:CCGGCTGAAGATATCCGGTGCAAATCTCGAGATTTGCACCGGATATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-438s21c1
Sequence:CCGGATACTGAGCAGCTGCACAATGCTCGAGCATTGTGCAGCTGCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-708s21c1
Sequence:CCGGTCAAATGCCCATGGCGTTTATCTCGAGATAAACGCCATGGGCATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-183s21c1
Sequence:CCGGGAAACATCAGCGGGCACATTTCTCGAGAAATGTGCCCGCTGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025439.2-328s21c1
Sequence:CCGGCACAACCATCAAGGTCATTATCTCGAGATAATGACCTTGATGGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016456
VALIDATED
TMEM9 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016456.2-474s1c1
Sequence:CCGGCCGGATGCATATACTGAGCAACTCGAGTTGCTCAGTATATGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-211s1c1
Sequence:CCGGGCATCTGTCCACCTTATAGAACTCGAGTTCTATAAGGTGGACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-383s1c1
Sequence:CCGGCAAGGTCATCATTGTCATCTACTCGAGTAGATGACAATGATGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016456.2-495s1c1
Sequence:CCGGCTGCACAATGAGGAGGAGAATCTCGAGATTCTCCTCCTCATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-243s1c1
Sequence:CCGGCACATTTACAACCAGAATGTACTCGAGTACATTCTGGTTGTAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016456.3-494s21c1
Sequence:CCGGAGGATGCTCGCTCTATGGCAGCTCGAGCTGCCATAGAGCGAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016456.3-850s21c1
Sequence:CCGGTGTTGTCTTCTTGGGTCTTTGCTCGAGCAAAGACCCAAGAAGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016456.3-795s21c1
Sequence:CCGGGAAATGTTGTACTTGGCTATTCTCGAGAATAGCCAAGTACAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016456.3-423s21c1
Sequence:CCGGGATGCTGGTGGACCCTCTGATCTCGAGATCAGAGGGTCCACCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016456
VALIDATED
TMEM9 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016456.2-474s1c1
Sequence:CCGGCCGGATGCATATACTGAGCAACTCGAGTTGCTCAGTATATGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-211s1c1
Sequence:CCGGGCATCTGTCCACCTTATAGAACTCGAGTTCTATAAGGTGGACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-383s1c1
Sequence:CCGGCAAGGTCATCATTGTCATCTACTCGAGTAGATGACAATGATGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016456.2-495s1c1
Sequence:CCGGCTGCACAATGAGGAGGAGAATCTCGAGATTCTCCTCCTCATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-243s1c1
Sequence:CCGGCACATTTACAACCAGAATGTACTCGAGTACATTCTGGTTGTAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016456.3-494s21c1
Sequence:CCGGAGGATGCTCGCTCTATGGCAGCTCGAGCTGCCATAGAGCGAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016456.3-850s21c1
Sequence:CCGGTGTTGTCTTCTTGGGTCTTTGCTCGAGCAAAGACCCAAGAAGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016456.3-795s21c1
Sequence:CCGGGAAATGTTGTACTTGGCTATTCTCGAGAATAGCCAAGTACAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016456.3-423s21c1
Sequence:CCGGGATGCTGGTGGACCCTCTGATCTCGAGATCAGAGGGTCCACCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016456
VALIDATED
TMEM9 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016456.2-474s1c1
Sequence:CCGGCCGGATGCATATACTGAGCAACTCGAGTTGCTCAGTATATGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-211s1c1
Sequence:CCGGGCATCTGTCCACCTTATAGAACTCGAGTTCTATAAGGTGGACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-383s1c1
Sequence:CCGGCAAGGTCATCATTGTCATCTACTCGAGTAGATGACAATGATGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016456.2-495s1c1
Sequence:CCGGCTGCACAATGAGGAGGAGAATCTCGAGATTCTCCTCCTCATTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016456.2-243s1c1
Sequence:CCGGCACATTTACAACCAGAATGTACTCGAGTACATTCTGGTTGTAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016456.3-494s21c1
Sequence:CCGGAGGATGCTCGCTCTATGGCAGCTCGAGCTGCCATAGAGCGAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016456.3-850s21c1
Sequence:CCGGTGTTGTCTTCTTGGGTCTTTGCTCGAGCAAAGACCCAAGAAGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016456.3-795s21c1
Sequence:CCGGGAAATGTTGTACTTGGCTATTCTCGAGAATAGCCAAGTACAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016456.3-423s21c1
Sequence:CCGGGATGCTGGTGGACCCTCTGATCTCGAGATCAGAGGGTCCACCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks