EMAIL THIS PAGE TO A FRIEND

TMEM9B

TMEM9 domain family, member B

Synonyms: C11orf15
UniProtKB ID: Q9NQ34
Gene ID:
Mouse(56786) TMEM9 domain family, member B
Rat(293415) TMEM9 domain family, member B
Zebrafish(325931) TMEM9 domain family, member B
dog(476843) TMEM9 domain family, member B
domestic cat(101085152) TMEM9 domain family, member B
chicken(423051) TMEM9 domain family, member B
naked mole-rat(101698629) TMEM9 domain family, member B
domestic guinea pig(100724338) TMEM9 domain family, member B
cow(515665) TMEM9 domain family, member B
sheep(101106198) TMEM9 domain family, member B
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020644 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020644 Rosetta Predictions human pricing
NM_001106289 Rosetta Predictions rat pricing
NM_020050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353623 predicted 223
2 SASI_Hs01_00048241 predicted 616
3 SASI_Hs01_00048242 predicted 383
4 SASI_Hs01_00048243 predicted 216
5 SASI_Hs01_00048244 predicted 463
6 SASI_Hs01_00048245 predicted 373
7 SASI_Hs01_00048246 predicted 463
8 SASI_Hs01_00048247 predicted 214
9 SASI_Hs01_00048248 predicted 529
10 SASI_Hs01_00048249 predicted 621
11 SASI_Hs01_00048240 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217508 predicted 464
2 SASI_Rn02_00217509 predicted 471
3 SASI_Rn02_00217510 predicted 419
4 SASI_Rn02_00217511 predicted 776
5 SASI_Rn02_00217512 predicted 519
6 SASI_Rn02_00217513 predicted 453
7 SASI_Rn02_00217514 predicted 428
8 SASI_Rn02_00217515 predicted 421
9 SASI_Rn02_00217516 predicted 734
10 SASI_Rn02_00217517 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169269 predicted 693
2 SASI_Mm01_00169270 predicted 229
3 SASI_Mm02_00325414 predicted 841
4 SASI_Mm01_00169271 predicted 381
5 SASI_Mm01_00169272 predicted 367
6 SASI_Mm01_00169273 predicted 199
7 SASI_Mm02_00325415 predicted 335
8 SASI_Mm01_00169274 predicted 345
9 SASI_Mm01_00169277 predicted 675
10 SASI_Mm02_00325416 predicted 879
11 SASI_Mm01_00169275 predicted 447
12 SASI_Mm01_00169276 predicted 402
13 SASI_Mm01_00169278 predicted 255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020050
VALIDATED
TMEM9B MISSION shRNA Bacterial Glycerol Stock
TMEM9 domain family, member B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020050.1-373s1c1
Sequence:CCGGGAGAAGCTCTGTCACAATCAACTCGAGTTGATTGTGACAGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020050.1-579s1c1
Sequence:CCGGGCCGAGCCAATGTTCTAAACACTCGAGTGTTTAGAACATTGGCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020050.1-239s1c1
Sequence:CCGGGAGAATCCTGGGCACATTTATCTCGAGATAAATGTGCCCAGGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020050.1-360s1c1
Sequence:CCGGGCAAATACGAAGAGAGAAGCTCTCGAGAGCTTCTCTCTTCGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020050.1-1366s1c1
Sequence:CCGGGCTAGTTTACACTGATACCTACTCGAGTAGGTATCAGTGTAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020050.1-383s1c1
Sequence:CCGGGTCACAATCAAGGTTACCATTCTCGAGAATGGTAACCTTGATTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-383s21c1
Sequence:CCGGGTCACAATCAAGGTTACCATTCTCGAGAATGGTAACCTTGATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020050.1-1487s1c1
Sequence:CCGGCTGGATGATTGACGTACAAATCTCGAGATTTGTACGTCAATCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020050.1-431s1c1
Sequence:CCGGCTGCTTCTGTACATGGTATATCTCGAGATATACCATGTACAGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-360s21c1
Sequence:CCGGGCAAATACGAAGAGAGAAGCTCTCGAGAGCTTCTCTCTTCGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-373s21c1
Sequence:CCGGGAGAAGCTCTGTCACAATCAACTCGAGTTGATTGTGACAGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-579s21c1
Sequence:CCGGGCCGAGCCAATGTTCTAAACACTCGAGTGTTTAGAACATTGGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020050
VALIDATED
TMEM9B MISSION shRNA shRNA Plasmid DNA
TMEM9 domain family, member B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020050.1-373s1c1
Sequence:CCGGGAGAAGCTCTGTCACAATCAACTCGAGTTGATTGTGACAGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020050.1-579s1c1
Sequence:CCGGGCCGAGCCAATGTTCTAAACACTCGAGTGTTTAGAACATTGGCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020050.1-239s1c1
Sequence:CCGGGAGAATCCTGGGCACATTTATCTCGAGATAAATGTGCCCAGGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020050.1-360s1c1
Sequence:CCGGGCAAATACGAAGAGAGAAGCTCTCGAGAGCTTCTCTCTTCGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020050.1-1366s1c1
Sequence:CCGGGCTAGTTTACACTGATACCTACTCGAGTAGGTATCAGTGTAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020050.1-383s1c1
Sequence:CCGGGTCACAATCAAGGTTACCATTCTCGAGAATGGTAACCTTGATTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-383s21c1
Sequence:CCGGGTCACAATCAAGGTTACCATTCTCGAGAATGGTAACCTTGATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020050.1-1487s1c1
Sequence:CCGGCTGGATGATTGACGTACAAATCTCGAGATTTGTACGTCAATCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020050.1-431s1c1
Sequence:CCGGCTGCTTCTGTACATGGTATATCTCGAGATATACCATGTACAGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-360s21c1
Sequence:CCGGGCAAATACGAAGAGAGAAGCTCTCGAGAGCTTCTCTCTTCGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-373s21c1
Sequence:CCGGGAGAAGCTCTGTCACAATCAACTCGAGTTGATTGTGACAGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-579s21c1
Sequence:CCGGGCCGAGCCAATGTTCTAAACACTCGAGTGTTTAGAACATTGGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020050
VALIDATED
TMEM9B MISSION shRNA Lentiviral Transduction Particles
TMEM9 domain family, member B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020050.1-373s1c1
Sequence:CCGGGAGAAGCTCTGTCACAATCAACTCGAGTTGATTGTGACAGAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020050.1-579s1c1
Sequence:CCGGGCCGAGCCAATGTTCTAAACACTCGAGTGTTTAGAACATTGGCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020050.1-239s1c1
Sequence:CCGGGAGAATCCTGGGCACATTTATCTCGAGATAAATGTGCCCAGGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020050.1-360s1c1
Sequence:CCGGGCAAATACGAAGAGAGAAGCTCTCGAGAGCTTCTCTCTTCGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020050.1-1366s1c1
Sequence:CCGGGCTAGTTTACACTGATACCTACTCGAGTAGGTATCAGTGTAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020050.1-383s1c1
Sequence:CCGGGTCACAATCAAGGTTACCATTCTCGAGAATGGTAACCTTGATTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-383s21c1
Sequence:CCGGGTCACAATCAAGGTTACCATTCTCGAGAATGGTAACCTTGATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020050.1-1487s1c1
Sequence:CCGGCTGGATGATTGACGTACAAATCTCGAGATTTGTACGTCAATCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020050.1-431s1c1
Sequence:CCGGCTGCTTCTGTACATGGTATATCTCGAGATATACCATGTACAGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-360s21c1
Sequence:CCGGGCAAATACGAAGAGAGAAGCTCTCGAGAGCTTCTCTCTTCGTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-373s21c1
Sequence:CCGGGAGAAGCTCTGTCACAATCAACTCGAGTTGATTGTGACAGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020050.1-579s21c1
Sequence:CCGGGCCGAGCCAATGTTCTAAACACTCGAGTGTTTAGAACATTGGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020644
VALIDATED
TMEM9B MISSION shRNA Bacterial Glycerol Stock
TMEM9 domain family, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-538s1c1
Sequence:CCGGGCACAGTTGATACAGAGTGATCTCGAGATCACTCTGTATCAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-379s1c1
Sequence:CCGGGCATACTGTCTACGCTGTGAACTCGAGTTCACAGCGTAGACAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-639s1c1
Sequence:CCGGCAAGGTAGAATATGCACAGCACTCGAGTGCTGTGCATATTCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020644.1-684s1c1
Sequence:CCGGGCAGCGAAAGTCTGTCTTTGACTCGAGTCAAAGACAGACTTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-1237s1c1
Sequence:CCGGGCCTCATCAAAGAGCTGACTTCTCGAGAAGTCAGCTCTTTGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020644.1-586s1c1
Sequence:CCGGGCAAATGCACACGATGTGCTACTCGAGTAGCACATCGTGTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-1238s1c1
Sequence:CCGGCCTCATCAAAGAGCTGACTTACTCGAGTAAGTCAGCTCTTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-419s1c1
Sequence:CCGGGCTCTGTCACAATCAAGGTTACTCGAGTAACCTTGATTGTGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-316s1c1
Sequence:CCGGCAGAAAGATTGTGATTGCCTTCTCGAGAAGGCAATCACAATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-1250s1c1
Sequence:CCGGGCTGACTTACTCATTTGACTTCTCGAGAAGTCAAATGAGTAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-322s1c1
Sequence:CCGGGATTGTGATTGCCTTCATGTTCTCGAGAACATGAAGGCAATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-370s1c1
Sequence:CCGGGATGTAGAAGCATACTGTCTACTCGAGTAGACAGTATGCTTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020644
VALIDATED
TMEM9B MISSION shRNA shRNA Plasmid DNA
TMEM9 domain family, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-538s1c1
Sequence:CCGGGCACAGTTGATACAGAGTGATCTCGAGATCACTCTGTATCAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-379s1c1
Sequence:CCGGGCATACTGTCTACGCTGTGAACTCGAGTTCACAGCGTAGACAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-639s1c1
Sequence:CCGGCAAGGTAGAATATGCACAGCACTCGAGTGCTGTGCATATTCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020644.1-684s1c1
Sequence:CCGGGCAGCGAAAGTCTGTCTTTGACTCGAGTCAAAGACAGACTTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-1237s1c1
Sequence:CCGGGCCTCATCAAAGAGCTGACTTCTCGAGAAGTCAGCTCTTTGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020644.1-586s1c1
Sequence:CCGGGCAAATGCACACGATGTGCTACTCGAGTAGCACATCGTGTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-1238s1c1
Sequence:CCGGCCTCATCAAAGAGCTGACTTACTCGAGTAAGTCAGCTCTTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-419s1c1
Sequence:CCGGGCTCTGTCACAATCAAGGTTACTCGAGTAACCTTGATTGTGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-316s1c1
Sequence:CCGGCAGAAAGATTGTGATTGCCTTCTCGAGAAGGCAATCACAATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-1250s1c1
Sequence:CCGGGCTGACTTACTCATTTGACTTCTCGAGAAGTCAAATGAGTAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-322s1c1
Sequence:CCGGGATTGTGATTGCCTTCATGTTCTCGAGAACATGAAGGCAATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-370s1c1
Sequence:CCGGGATGTAGAAGCATACTGTCTACTCGAGTAGACAGTATGCTTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020644
VALIDATED
TMEM9B MISSION shRNA Lentiviral Transduction Particles
TMEM9 domain family, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-538s1c1
Sequence:CCGGGCACAGTTGATACAGAGTGATCTCGAGATCACTCTGTATCAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-379s1c1
Sequence:CCGGGCATACTGTCTACGCTGTGAACTCGAGTTCACAGCGTAGACAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-639s1c1
Sequence:CCGGCAAGGTAGAATATGCACAGCACTCGAGTGCTGTGCATATTCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020644.1-684s1c1
Sequence:CCGGGCAGCGAAAGTCTGTCTTTGACTCGAGTCAAAGACAGACTTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-1237s1c1
Sequence:CCGGGCCTCATCAAAGAGCTGACTTCTCGAGAAGTCAGCTCTTTGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020644.1-586s1c1
Sequence:CCGGGCAAATGCACACGATGTGCTACTCGAGTAGCACATCGTGTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020644.1-1238s1c1
Sequence:CCGGCCTCATCAAAGAGCTGACTTACTCGAGTAAGTCAGCTCTTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-419s1c1
Sequence:CCGGGCTCTGTCACAATCAAGGTTACTCGAGTAACCTTGATTGTGACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-316s1c1
Sequence:CCGGCAGAAAGATTGTGATTGCCTTCTCGAGAAGGCAATCACAATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020644.1-1250s1c1
Sequence:CCGGGCTGACTTACTCATTTGACTTCTCGAGAAGTCAAATGAGTAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-322s1c1
Sequence:CCGGGATTGTGATTGCCTTCATGTTCTCGAGAACATGAAGGCAATCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020644.1-370s1c1
Sequence:CCGGGATGTAGAAGCATACTGTCTACTCGAGTAGACAGTATGCTTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks