EMAIL THIS PAGE TO A FRIEND

TMF1

TATA element modulatory factor 1

Synonyms: ARA160 TMF
UniProtKB ID: P82094, B7ZLJ2, Q17R87, Q59GK0
Gene ID:
Mouse(232286) TATA element modulatory factor 1
Rat(114206) TATA element modulatory factor 1
cow(616786) TATA element modulatory factor 1
sheep(101116869) TATA element modulatory factor 1
domestic guinea pig(100731484) TATA element modulatory factor 1
naked mole-rat(101716406) TATA element modulatory factor 1
Domestic Rabbit(100342798) TATA element modulatory factor 1
Zebrafish(445128) TATA element modulatory factor 1
Horse(100053441) TATA element modulatory factor 1
chicken(426072) TATA element modulatory factor 1
dog(476561) TATA element modulatory factor 1
domestic cat(101089927) TATA element modulatory factor 1
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102479 Anti-TMF1 (ab1) antibody produced in rabbit affinity isolated antibody canine, horse, human, guinea pig, rat, mouse
western blot pricing
SAB2102480 Anti-TMF1 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human, mouse
western blot pricing
HPA008729 Anti-TMF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007114 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007114 Rosetta Predictions human pricing
NM_053671 Rosetta Predictions rat pricing
NM_001081111 Rosetta Predictions mouse pricing
XM_132740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192875 predicted 865
2 SASI_Hs02_00342984 predicted 3378
3 SASI_Hs01_00192877 predicted 724
4 SASI_Hs02_00342985 predicted 370
5 SASI_Hs01_00192879 predicted 3242
6 SASI_Hs02_00342986 predicted 3350
7 SASI_Hs02_00342987 predicted 3184
8 SASI_Hs01_00192881 predicted 783
9 SASI_Hs01_00192882 predicted 1291
10 SASI_Hs02_00342988 predicted 3405
11 SASI_Hs01_00192876 predicted 2378
12 SASI_Hs01_00192878 predicted 2866
13 SASI_Hs01_00192880 predicted 2667
14 SASI_Hs01_00192883 predicted 1341
15 SASI_Hs01_00192884 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266403 predicted 717
2 SASI_Rn02_00266404 predicted 3195
3 SASI_Rn02_00266405 predicted 1891
4 SASI_Rn02_00266406 predicted 2094
5 SASI_Rn02_00266407 predicted 2318
6 SASI_Rn02_00266408 predicted 2272
7 SASI_Rn02_00266409 predicted 2062
8 SASI_Rn02_00266410 predicted 1028
9 SASI_Rn02_00266411 predicted 2341
10 SASI_Rn02_00266412 predicted 1735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295291 predicted 1062
2 SASI_Mm02_00295292 predicted 3217
3 SASI_Mm02_00295293 predicted 1442
4 SASI_Mm02_00295294 predicted 2956
5 SASI_Mm02_00295295 predicted 1908
6 SASI_Mm02_00295296 predicted 847
7 SASI_Mm02_00295297 predicted 2115
8 SASI_Mm02_00295298 predicted 492
9 SASI_Mm02_00295299 predicted 1431
10 SASI_Mm02_00295300 predicted 2896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249766 predicted 1697
2 SASI_Mm01_00249767 predicted 3218
3 SASI_Mm01_00249768 predicted 2959
4 SASI_Mm01_00249769 predicted 1912
5 SASI_Mm01_00249770 predicted 853
6 SASI_Mm01_00249771 predicted 2120
7 SASI_Mm01_00249772 predicted 490
8 SASI_Mm01_00249773 predicted 1432
9 SASI_Mm01_00249774 predicted 2899
10 SASI_Mm01_00249775 predicted 2088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007114
VALIDATED
TMF1 MISSION shRNA Bacterial Glycerol Stock
TATA element modulatory factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007114.2-375s21c1
Sequence:CCGGCGTATGGAGAGCCGGGAATAACTCGAGTTATTCCCGGCTCTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007114.2-2443s21c1
Sequence:CCGGTGCCAGAAAGGAGGATTATTTCTCGAGAAATAATCCTCCTTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007114.2-1303s21c1
Sequence:CCGGATATGCTTTAGTGCCTATTATCTCGAGATAATAGGCACTAAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007114.2-2786s21c1
Sequence:CCGGGCCCAGCTAGAATCAGAGAAACTCGAGTTTCTCTGATTCTAGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007114.2-3779s21c1
Sequence:CCGGGAATAGCACAGAGATTTATTACTCGAGTAATAAATCTCTGTGCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-2194s1c1
Sequence:CCGGGCTGCCAGAAAGGAGGATTATCTCGAGATAATCCTCCTTTCTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007114.1-1710s1c1
Sequence:CCGGGCACAATTCTAACATCATCAACTCGAGTTGATGATGTTAGAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-3116s1c1
Sequence:CCGGCCAAACTTAGAACTCAGCTAACTCGAGTTAGCTGAGTTCTAAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_007114.1-2887s1c1
Sequence:CCGGCCAATGCCTATATCAGCCAAACTCGAGTTTGGCTGATATAGGCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-2539s1c1
Sequence:CCGGGCCCAGCTAGAATCAGAGAAACTCGAGTTTCTCTGATTCTAGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007114
VALIDATED
TMF1 MISSION shRNA shRNA Plasmid DNA
TATA element modulatory factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007114.2-375s21c1
Sequence:CCGGCGTATGGAGAGCCGGGAATAACTCGAGTTATTCCCGGCTCTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007114.2-2443s21c1
Sequence:CCGGTGCCAGAAAGGAGGATTATTTCTCGAGAAATAATCCTCCTTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007114.2-1303s21c1
Sequence:CCGGATATGCTTTAGTGCCTATTATCTCGAGATAATAGGCACTAAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007114.2-2786s21c1
Sequence:CCGGGCCCAGCTAGAATCAGAGAAACTCGAGTTTCTCTGATTCTAGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007114.2-3779s21c1
Sequence:CCGGGAATAGCACAGAGATTTATTACTCGAGTAATAAATCTCTGTGCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-2194s1c1
Sequence:CCGGGCTGCCAGAAAGGAGGATTATCTCGAGATAATCCTCCTTTCTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007114.1-1710s1c1
Sequence:CCGGGCACAATTCTAACATCATCAACTCGAGTTGATGATGTTAGAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-3116s1c1
Sequence:CCGGCCAAACTTAGAACTCAGCTAACTCGAGTTAGCTGAGTTCTAAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_007114.1-2887s1c1
Sequence:CCGGCCAATGCCTATATCAGCCAAACTCGAGTTTGGCTGATATAGGCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-2539s1c1
Sequence:CCGGGCCCAGCTAGAATCAGAGAAACTCGAGTTTCTCTGATTCTAGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007114
VALIDATED
TMF1 MISSION shRNA Lentiviral Transduction Particles
TATA element modulatory factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007114.2-375s21c1
Sequence:CCGGCGTATGGAGAGCCGGGAATAACTCGAGTTATTCCCGGCTCTCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007114.2-2443s21c1
Sequence:CCGGTGCCAGAAAGGAGGATTATTTCTCGAGAAATAATCCTCCTTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007114.2-1303s21c1
Sequence:CCGGATATGCTTTAGTGCCTATTATCTCGAGATAATAGGCACTAAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007114.2-2786s21c1
Sequence:CCGGGCCCAGCTAGAATCAGAGAAACTCGAGTTTCTCTGATTCTAGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007114.2-3779s21c1
Sequence:CCGGGAATAGCACAGAGATTTATTACTCGAGTAATAAATCTCTGTGCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-2194s1c1
Sequence:CCGGGCTGCCAGAAAGGAGGATTATCTCGAGATAATCCTCCTTTCTGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007114.1-1710s1c1
Sequence:CCGGGCACAATTCTAACATCATCAACTCGAGTTGATGATGTTAGAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-3116s1c1
Sequence:CCGGCCAAACTTAGAACTCAGCTAACTCGAGTTAGCTGAGTTCTAAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_007114.1-2887s1c1
Sequence:CCGGCCAATGCCTATATCAGCCAAACTCGAGTTTGGCTGATATAGGCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007114.1-2539s1c1
Sequence:CCGGGCCCAGCTAGAATCAGAGAAACTCGAGTTTCTCTGATTCTAGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081111
TMF1 MISSION shRNA Bacterial Glycerol Stock
TATA element modulatory factor 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000238645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-3218s21c1
Sequence:CCGGTCGAGTTCAGCTGCGAGATTTCTCGAGAAATCTCGCAGCTGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-2589s21c1
Sequence:CCGGGAGTCACAGAATACGTTATTACTCGAGTAATAACGTATTCTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-1146s21c1
Sequence:CCGGTATGCTTTAGTACCCATAATACTCGAGTATTATGGGTACTAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-3144s21c1
Sequence:CCGGATGTCCGAAGAGCTAGTTAAACTCGAGTTTAACTAGCTCTTCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081111
TMF1 MISSION shRNA shRNA Plasmid DNA
TATA element modulatory factor 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000238645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-3218s21c1
Sequence:CCGGTCGAGTTCAGCTGCGAGATTTCTCGAGAAATCTCGCAGCTGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-2589s21c1
Sequence:CCGGGAGTCACAGAATACGTTATTACTCGAGTAATAACGTATTCTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-1146s21c1
Sequence:CCGGTATGCTTTAGTACCCATAATACTCGAGTATTATGGGTACTAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-3144s21c1
Sequence:CCGGATGTCCGAAGAGCTAGTTAAACTCGAGTTTAACTAGCTCTTCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081111
TMF1 MISSION shRNA Lentiviral Transduction Particles
TATA element modulatory factor 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000238645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-3218s21c1
Sequence:CCGGTCGAGTTCAGCTGCGAGATTTCTCGAGAAATCTCGCAGCTGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-2589s21c1
Sequence:CCGGGAGTCACAGAATACGTTATTACTCGAGTAATAACGTATTCTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-1146s21c1
Sequence:CCGGTATGCTTTAGTACCCATAATACTCGAGTATTATGGGTACTAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081111.1-3144s21c1
Sequence:CCGGATGTCCGAAGAGCTAGTTAAACTCGAGTTTAACTAGCTCTTCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks