EMAIL THIS PAGE TO A FRIEND

TMIE

transmembrane inner ear

Synonyms: DFNB6
UniProtKB ID: Q8NEW7, A0AV93, A8K0R0
Gene ID:
Human(259236) Summary: This gene encodes a transmembrane inner ear protein. Studies in mouse suggest that this gene is required for normal postnatal maturation of sensory hair cells in the cochlea, including correct development of stereocilia bundles. This gene is one of multiple genes responsible for recessive non-syndromic deafness (DFNB), also known as autosomal recessive nonsyndromic hearing loss (ARNSHL), the most common form of congenitally acquired inherited hearing impairment. [provided by RefSeq, Mar 2009]
Mouse(20776) transmembrane inner ear
Rat(501061) transmembrane inner ear
Zebrafish(555430) transmembrane inner ear
domestic cat(101084267) transmembrane inner ear
dog(609350) transmembrane inner ear
chicken(769596) transmembrane inner ear
naked mole-rat(101720816) transmembrane inner ear
domestic guinea pig(100717497) transmembrane inner ear
cow(617572) transmembrane inner ear
sheep(101116181) transmembrane inner ear
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147196 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147196 Rosetta Predictions human pricing
NM_001109299 Rosetta Predictions rat pricing
NM_146260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152757 predicted 1102
2 SASI_Hs01_00152754 predicted 957
3 SASI_Hs01_00152755 predicted 1015
4 SASI_Hs01_00152756 predicted 928
5 SASI_Hs01_00152758 predicted 345
6 SASI_Hs02_00365537 predicted 444
7 SASI_Hs01_00152753 predicted 782
8 SASI_Hs01_00152760 predicted 441
9 SASI_Hs01_00152761 predicted 687
10 SASI_Hs02_00365538 predicted 1011
11 SASI_Hs01_00152759 predicted 561
12 SASI_Hs01_00152762 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247054 predicted 1579
2 SASI_Rn02_00247055 predicted 2106
3 SASI_Rn02_00247056 predicted 1498
4 SASI_Rn02_00247057 predicted 2176
5 SASI_Rn02_00247058 predicted 2116
6 SASI_Rn02_00247059 predicted 1936
7 SASI_Rn02_00247060 predicted 1933
8 SASI_Rn02_00247061 predicted 2123
9 SASI_Rn02_00247062 predicted 1839
10 SASI_Rn02_00247063 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342003 predicted 1864
2 SASI_Mm01_00174704 predicted 1456
3 SASI_Mm02_00342004 predicted 1853
4 SASI_Mm02_00342005 predicted 1450
5 SASI_Mm01_00174706 predicted 1434
6 SASI_Mm01_00174708 predicted 1778
7 SASI_Mm01_00174709 predicted 1752
8 SASI_Mm02_00342006 predicted 2060
9 SASI_Mm02_00342007 predicted 1441
10 SASI_Mm02_00342008 predicted 1968
11 SASI_Mm01_00174701 predicted 1352
12 SASI_Mm01_00174702 predicted 1688
13 SASI_Mm01_00174703 predicted 1597
14 SASI_Mm01_00174705 predicted 1423
15 SASI_Mm01_00174707 predicted 1563
16 SASI_Mm01_00174710 predicted 1556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146260
TMIE MISSION shRNA Bacterial Glycerol Stock
transmembrane inner ear
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146260.1-2074s1c1
Sequence:CCGGCGCCTCAAATAGCAAGGAGATCTCGAGATCTCCTTGCTATTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1377s1c1
Sequence:CCGGCATCACGCTATGCTGTGTCTTCTCGAGAAGACACAGCATAGCGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1600s1c1
Sequence:CCGGGCCAAGAAGAAAGGAGAGAAACTCGAGTTTCTCTCCTTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1356s1c1
Sequence:CCGGGCTCTTCGTGTTGTCCATCATCTCGAGATGATGGACAACACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1496s1c1
Sequence:CCGGCCCTTAATGAACTCACAGAAACTCGAGTTTCTGTGAGTTCATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146260
TMIE MISSION shRNA shRNA Plasmid DNA
transmembrane inner ear
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146260.1-2074s1c1
Sequence:CCGGCGCCTCAAATAGCAAGGAGATCTCGAGATCTCCTTGCTATTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1377s1c1
Sequence:CCGGCATCACGCTATGCTGTGTCTTCTCGAGAAGACACAGCATAGCGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1600s1c1
Sequence:CCGGGCCAAGAAGAAAGGAGAGAAACTCGAGTTTCTCTCCTTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1356s1c1
Sequence:CCGGGCTCTTCGTGTTGTCCATCATCTCGAGATGATGGACAACACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1496s1c1
Sequence:CCGGCCCTTAATGAACTCACAGAAACTCGAGTTTCTGTGAGTTCATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146260
TMIE MISSION shRNA Lentiviral Transduction Particles
transmembrane inner ear
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146260.1-2074s1c1
Sequence:CCGGCGCCTCAAATAGCAAGGAGATCTCGAGATCTCCTTGCTATTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1377s1c1
Sequence:CCGGCATCACGCTATGCTGTGTCTTCTCGAGAAGACACAGCATAGCGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1600s1c1
Sequence:CCGGGCCAAGAAGAAAGGAGAGAAACTCGAGTTTCTCTCCTTTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1356s1c1
Sequence:CCGGGCTCTTCGTGTTGTCCATCATCTCGAGATGATGGACAACACGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146260.1-1496s1c1
Sequence:CCGGCCCTTAATGAACTCACAGAAACTCGAGTTTCTGTGAGTTCATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147196
TMIE MISSION shRNA Bacterial Glycerol Stock
transmembrane inner ear
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147196.1-1414s1c1
Sequence:CCGGCCTCTTGGGAATCAGAGTATACTCGAGTATACTCTGATTCCCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-512s1c1
Sequence:CCGGAGGAGAGGATAAGAAGAAGAACTCGAGTTCTTCTTCTTATCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-509s1c1
Sequence:CCGGCCCAGGAGAGGATAAGAAGAACTCGAGTTCTTCTTATCCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-564s1c1
Sequence:CCGGGCCATCAAAGTAGAGGAGGATCTCGAGATCCTCCTCTACTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-437s1c1
Sequence:CCGGGCAGCGAAAGGCAGCCAAGATCTCGAGATCTTGGCTGCCTTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147196
TMIE MISSION shRNA shRNA Plasmid DNA
transmembrane inner ear
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147196.1-1414s1c1
Sequence:CCGGCCTCTTGGGAATCAGAGTATACTCGAGTATACTCTGATTCCCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-512s1c1
Sequence:CCGGAGGAGAGGATAAGAAGAAGAACTCGAGTTCTTCTTCTTATCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-509s1c1
Sequence:CCGGCCCAGGAGAGGATAAGAAGAACTCGAGTTCTTCTTATCCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-564s1c1
Sequence:CCGGGCCATCAAAGTAGAGGAGGATCTCGAGATCCTCCTCTACTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-437s1c1
Sequence:CCGGGCAGCGAAAGGCAGCCAAGATCTCGAGATCTTGGCTGCCTTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147196
TMIE MISSION shRNA Lentiviral Transduction Particles
transmembrane inner ear
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147196.1-1414s1c1
Sequence:CCGGCCTCTTGGGAATCAGAGTATACTCGAGTATACTCTGATTCCCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-512s1c1
Sequence:CCGGAGGAGAGGATAAGAAGAAGAACTCGAGTTCTTCTTCTTATCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-509s1c1
Sequence:CCGGCCCAGGAGAGGATAAGAAGAACTCGAGTTCTTCTTATCCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-564s1c1
Sequence:CCGGGCCATCAAAGTAGAGGAGGATCTCGAGATCCTCCTCTACTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147196.1-437s1c1
Sequence:CCGGGCAGCGAAAGGCAGCCAAGATCTCGAGATCTTGGCTGCCTTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks