EMAIL THIS PAGE TO A FRIEND

TMIGD1

transmembrane and immunoglobulin domain containing 1

Synonyms: TMIGD UNQ9372
UniProtKB ID: Q6UXZ0, A8K2K1, Q6ZMC6
Gene ID:
Mouse(66601) transmembrane and immunoglobulin domain containing 1
Rat(363654) transmembrane and immunoglobulin domain containing 1
cow(506345) transmembrane and immunoglobulin domain containing 1
sheep(101112072) transmembrane and immunoglobulin domain containing 1
domestic guinea pig(100717272) transmembrane and immunoglobulin domain containing 1
naked mole-rat(101706788) transmembrane and immunoglobulin domain containing 1
Zebrafish(559127) transmembrane and immunoglobulin domain containing 1
domestic cat(101090660) transmembrane and immunoglobulin domain containing 1
dog(611097) transmembrane and immunoglobulin domain containing 1
chicken(101751326) transmembrane and immunoglobulin domain containing 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206832 Rosetta Predictions human pricing
NM_025655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233084 predicted 516
2 SASI_Hs01_00233085 predicted 780
3 SASI_Hs01_00233086 predicted 287
4 SASI_Hs01_00233088 predicted 216
5 SASI_Hs01_00233089 predicted 537
6 SASI_Hs01_00233090 predicted 645
7 SASI_Hs01_00233091 predicted 357
8 SASI_Hs01_00233093 predicted 571
9 SASI_Hs02_00373559 predicted 694
10 SASI_Hs02_00373560 predicted 690
11 SASI_Hs01_00233087 predicted 847
12 SASI_Hs01_00233092 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022131 predicted 316
2 SASI_Mm01_00022132 predicted 584
3 SASI_Mm01_00022133 predicted 223
4 SASI_Mm01_00022134 predicted 472
5 SASI_Mm01_00022135 predicted 221
6 SASI_Mm01_00022136 predicted 1129
7 SASI_Mm01_00022137 predicted 330
8 SASI_Mm01_00022138 predicted 339
9 SASI_Mm01_00022139 predicted 1041
10 SASI_Mm02_00328777 predicted 1121
11 SASI_Mm01_00022130 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206832
TMIGD1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and immunoglobulin domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-726s1c1
Sequence:CCGGGTGTACCAATAGAGCCCATTACTCGAGTAATGGGCTCTATTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-610s1c1
Sequence:CCGGGCTGTCAATCACCAAAGTCGACTCGAGTCGACTTTGGTGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-640s1c1
Sequence:CCGGCAACGGAACCTACAGTTGTATCTCGAGATACAACTGTAGGTTCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-586s1c1
Sequence:CCGGCCAACAGACAAGTGAGTCTTTCTCGAGAAAGACTCACTTGTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-458s1c1
Sequence:CCGGGACTTCCAAACAGTTGAGGAACTCGAGTTCCTCAACTGTTTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206832.1-876s1c1
Sequence:CCGGCCATCGAATACAGAGAGAGTTCTCGAGAACTCTCTCTGTATTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-143s1c1
Sequence:CCGGCGTGAGATGACAAGTTCTGTTCTCGAGAACAGAACTTGTCATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-480s1c1
Sequence:CCGGGCAGTAATGTGAAGTTGGTTTCTCGAGAAACCAACTTCACATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206832
TMIGD1 MISSION shRNA shRNA Plasmid DNA
transmembrane and immunoglobulin domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-726s1c1
Sequence:CCGGGTGTACCAATAGAGCCCATTACTCGAGTAATGGGCTCTATTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-610s1c1
Sequence:CCGGGCTGTCAATCACCAAAGTCGACTCGAGTCGACTTTGGTGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-640s1c1
Sequence:CCGGCAACGGAACCTACAGTTGTATCTCGAGATACAACTGTAGGTTCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-586s1c1
Sequence:CCGGCCAACAGACAAGTGAGTCTTTCTCGAGAAAGACTCACTTGTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-458s1c1
Sequence:CCGGGACTTCCAAACAGTTGAGGAACTCGAGTTCCTCAACTGTTTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206832.1-876s1c1
Sequence:CCGGCCATCGAATACAGAGAGAGTTCTCGAGAACTCTCTCTGTATTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-143s1c1
Sequence:CCGGCGTGAGATGACAAGTTCTGTTCTCGAGAACAGAACTTGTCATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-480s1c1
Sequence:CCGGGCAGTAATGTGAAGTTGGTTTCTCGAGAAACCAACTTCACATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206832
TMIGD1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and immunoglobulin domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-726s1c1
Sequence:CCGGGTGTACCAATAGAGCCCATTACTCGAGTAATGGGCTCTATTGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-610s1c1
Sequence:CCGGGCTGTCAATCACCAAAGTCGACTCGAGTCGACTTTGGTGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-640s1c1
Sequence:CCGGCAACGGAACCTACAGTTGTATCTCGAGATACAACTGTAGGTTCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-586s1c1
Sequence:CCGGCCAACAGACAAGTGAGTCTTTCTCGAGAAAGACTCACTTGTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206832.1-458s1c1
Sequence:CCGGGACTTCCAAACAGTTGAGGAACTCGAGTTCCTCAACTGTTTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206832.1-876s1c1
Sequence:CCGGCCATCGAATACAGAGAGAGTTCTCGAGAACTCTCTCTGTATTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-143s1c1
Sequence:CCGGCGTGAGATGACAAGTTCTGTTCTCGAGAACAGAACTTGTCATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206832.1-480s1c1
Sequence:CCGGGCAGTAATGTGAAGTTGGTTTCTCGAGAAACCAACTTCACATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025655
TMIGD1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and immunoglobulin domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-470s1c1
Sequence:CCGGAGCGCAAATGATGTGGTATAACTCGAGTTATACCACATCATTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-471s1c1
Sequence:CCGGGCGCAAATGATGTGGTATAAACTCGAGTTTATACCACATCATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-291s1c1
Sequence:CCGGCCCATCAACGAAAGTGACAATCTCGAGATTGTCACTTTCGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-384s1c1
Sequence:CCGGCCTCCTCTTCTAAGTGGCAATCTCGAGATTGCCACTTAGAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025655.1-890s1c1
Sequence:CCGGCGTCTGTATTTATTGCCATTTCTCGAGAAATGGCAATAAATACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025655
TMIGD1 MISSION shRNA shRNA Plasmid DNA
transmembrane and immunoglobulin domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-470s1c1
Sequence:CCGGAGCGCAAATGATGTGGTATAACTCGAGTTATACCACATCATTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-471s1c1
Sequence:CCGGGCGCAAATGATGTGGTATAAACTCGAGTTTATACCACATCATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-291s1c1
Sequence:CCGGCCCATCAACGAAAGTGACAATCTCGAGATTGTCACTTTCGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-384s1c1
Sequence:CCGGCCTCCTCTTCTAAGTGGCAATCTCGAGATTGCCACTTAGAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025655.1-890s1c1
Sequence:CCGGCGTCTGTATTTATTGCCATTTCTCGAGAAATGGCAATAAATACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025655
TMIGD1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and immunoglobulin domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-470s1c1
Sequence:CCGGAGCGCAAATGATGTGGTATAACTCGAGTTATACCACATCATTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-471s1c1
Sequence:CCGGGCGCAAATGATGTGGTATAAACTCGAGTTTATACCACATCATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-291s1c1
Sequence:CCGGCCCATCAACGAAAGTGACAATCTCGAGATTGTCACTTTCGTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025655.1-384s1c1
Sequence:CCGGCCTCCTCTTCTAAGTGGCAATCTCGAGATTGCCACTTAGAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025655.1-890s1c1
Sequence:CCGGCGTCTGTATTTATTGCCATTTCTCGAGAAATGGCAATAAATACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks