EMAIL THIS PAGE TO A FRIEND

TMIGD2

transmembrane and immunoglobulin domain containing 2

Synonyms: IGPR-1 IGPR1
UniProtKB ID: Q96BF3, Q6UW59
Gene ID:
domestic cat(101101546) transmembrane and immunoglobulin domain containing 2
naked mole-rat(101715688) transmembrane and immunoglobulin domain containing 2
domestic guinea pig(100732701) transmembrane and immunoglobulin domain containing 2
cow(524354) transmembrane and immunoglobulin domain containing 2
sheep(101115367) transmembrane and immunoglobulin domain containing 2
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139191 MISSION® esiRNA esiRNA human TMIGD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115178 predicted 202
2 SASI_Hs01_00115179 predicted 196
3 SASI_Hs01_00115180 predicted 237
4 SASI_Hs01_00115181 predicted 381
5 SASI_Hs01_00115182 predicted 472
6 SASI_Hs01_00115184 predicted 382
7 SASI_Hs01_00115185 predicted 521
8 SASI_Hs02_00364436 predicted 341
9 SASI_Hs02_00364437 predicted 402
10 SASI_Hs01_00115186 predicted 480
11 SASI_Hs01_00115183 predicted 530
12 SASI_Hs01_00115187 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144615
TMIGD2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and immunoglobulin domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-703s1c1
Sequence:CCGGGAGCATTTATTCAACCTCCTTCTCGAGAAGGAGGTTGAATAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-424s1c1
Sequence:CCGGCAACATAACAAGGCTCTTTGTCTCGAGACAAAGAGCCTTGTTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-606s1c1
Sequence:CCGGCAGGAAATGCATTCTACAGCACTCGAGTGCTGTAGAATGCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-460s1c1
Sequence:CCGGCACACAGAACAGAAACCGGATCTCGAGATCCGGTTTCTGTTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-654s1c1
Sequence:CCGGCAAAGAAGAGTGAGGACTGCTCTCGAGAGCAGTCCTCACTCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-603s1c1
Sequence:CCGGGCCCAGGAAATGCATTCTACACTCGAGTGTAGAATGCATTTCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-614s1c1
Sequence:CCGGGCATTCTACAGCAACGTCCTACTCGAGTAGGACGTTGCTGTAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-238s1c1
Sequence:CCGGCATCCTGTGTCAACCGTACATCTCGAGATGTACGGTTGACACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-208s1c1
Sequence:CCGGGCTCCGTGTTAAGTGGACAAACTCGAGTTTGTCCACTTAACACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-391s1c1
Sequence:CCGGCGTAGAGATTCCTGAGTTGGACTCGAGTCCAACTCAGGAATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144615
TMIGD2 MISSION shRNA shRNA Plasmid DNA
transmembrane and immunoglobulin domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-703s1c1
Sequence:CCGGGAGCATTTATTCAACCTCCTTCTCGAGAAGGAGGTTGAATAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-424s1c1
Sequence:CCGGCAACATAACAAGGCTCTTTGTCTCGAGACAAAGAGCCTTGTTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-606s1c1
Sequence:CCGGCAGGAAATGCATTCTACAGCACTCGAGTGCTGTAGAATGCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-460s1c1
Sequence:CCGGCACACAGAACAGAAACCGGATCTCGAGATCCGGTTTCTGTTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-654s1c1
Sequence:CCGGCAAAGAAGAGTGAGGACTGCTCTCGAGAGCAGTCCTCACTCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-603s1c1
Sequence:CCGGGCCCAGGAAATGCATTCTACACTCGAGTGTAGAATGCATTTCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-614s1c1
Sequence:CCGGGCATTCTACAGCAACGTCCTACTCGAGTAGGACGTTGCTGTAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-238s1c1
Sequence:CCGGCATCCTGTGTCAACCGTACATCTCGAGATGTACGGTTGACACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-208s1c1
Sequence:CCGGGCTCCGTGTTAAGTGGACAAACTCGAGTTTGTCCACTTAACACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-391s1c1
Sequence:CCGGCGTAGAGATTCCTGAGTTGGACTCGAGTCCAACTCAGGAATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144615
TMIGD2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and immunoglobulin domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-703s1c1
Sequence:CCGGGAGCATTTATTCAACCTCCTTCTCGAGAAGGAGGTTGAATAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-424s1c1
Sequence:CCGGCAACATAACAAGGCTCTTTGTCTCGAGACAAAGAGCCTTGTTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-606s1c1
Sequence:CCGGCAGGAAATGCATTCTACAGCACTCGAGTGCTGTAGAATGCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-460s1c1
Sequence:CCGGCACACAGAACAGAAACCGGATCTCGAGATCCGGTTTCTGTTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-654s1c1
Sequence:CCGGCAAAGAAGAGTGAGGACTGCTCTCGAGAGCAGTCCTCACTCTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144615.1-603s1c1
Sequence:CCGGGCCCAGGAAATGCATTCTACACTCGAGTGTAGAATGCATTTCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-614s1c1
Sequence:CCGGGCATTCTACAGCAACGTCCTACTCGAGTAGGACGTTGCTGTAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-238s1c1
Sequence:CCGGCATCCTGTGTCAACCGTACATCTCGAGATGTACGGTTGACACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-208s1c1
Sequence:CCGGGCTCCGTGTTAAGTGGACAAACTCGAGTTTGTCCACTTAACACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144615.1-391s1c1
Sequence:CCGGCGTAGAGATTCCTGAGTTGGACTCGAGTCCAACTCAGGAATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks