EMAIL THIS PAGE TO A FRIEND

TMLHE

trimethyllysine hydroxylase, epsilon

Synonyms: AUTSX6 BBOX2 TMLD TMLH TMLHED XAP130
UniProtKB ID: Q9NVH6, A8K6M9, B4E3R3, Q5TZB5, Q6IA90, Q8TBT0
Gene ID:
Human(55217) Summary: This gene encodes the protein trimethyllysine dioxygenase which is the first enzyme in the carnitine biosynthesis pathway. Carnitine play an essential role in the transport of activated fatty acids across the inner mitochondrial membrane. The encoded protein converts trimethyllysine into hydroxytrimethyllysine. A pseudogene of this gene is found on chromosome X. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(192289) trimethyllysine hydroxylase, epsilon
Rat(170898) trimethyllysine hydroxylase, epsilon
Zebrafish(555271) trimethyllysine hydroxylase, epsilon
chicken(422296) trimethyllysine hydroxylase, epsilon
domestic cat(101094166) trimethyllysine hydroxylase, epsilon
dog(481090) trimethyllysine hydroxylase, epsilon
cow(535630) trimethyllysine hydroxylase, epsilon
sheep(101106308) trimethyllysine hydroxylase, epsilon
domestic guinea pig(100730686) trimethyllysine hydroxylase, epsilon
naked mole-rat(101700950) trimethyllysine hydroxylase, epsilon
Domestic Rabbit(100338782) trimethyllysine hydroxylase, epsilon
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018196 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018196 Rosetta Predictions human pricing
NM_133387 Rosetta Predictions rat pricing
NM_138758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119952 predicted 513
2 SASI_Hs01_00119953 predicted 440
3 SASI_Hs02_00351478 predicted 999
4 SASI_Hs01_00119955 predicted 391
5 SASI_Hs01_00119956 predicted 623
6 SASI_Hs01_00119957 predicted 1108
7 SASI_Hs01_00119958 predicted 1331
8 SASI_Hs01_00119959 predicted 966
9 SASI_Hs01_00119960 predicted 1108
10 SASI_Hs01_00119961 predicted 697
11 SASI_Hs01_00119954 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267647 predicted 742
2 SASI_Rn01_00117185 predicted 642
3 SASI_Rn01_00117186 predicted 1211
4 SASI_Rn01_00117187 predicted 406
5 SASI_Rn01_00117188 predicted 674
6 SASI_Rn01_00117189 predicted 321
7 SASI_Rn01_00117190 predicted 1085
8 SASI_Rn01_00117192 predicted 1087
9 SASI_Rn01_00117193 predicted 1210
10 SASI_Rn01_00117194 predicted 1000
11 SASI_Rn01_00117191 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339822 predicted 366
2 SASI_Mm02_00339823 predicted 599
3 SASI_Mm02_00339824 predicted 1227
4 SASI_Mm02_00339825 predicted 1150
5 SASI_Mm02_00339826 predicted 1040
6 SASI_Mm02_00339827 predicted 1338
7 SASI_Mm02_00339828 predicted 1192
8 SASI_Mm02_00339829 predicted 684
9 SASI_Mm02_00339830 predicted 1296
10 SASI_Mm02_00339831 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138758
VALIDATED
TMLHE MISSION shRNA Bacterial Glycerol Stock
trimethyllysine hydroxylase, epsilon
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1254s1c1
Sequence:CCGGCCTGGAAAGGTACTATTTATACTCGAGTATAAATAGTACCTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1201s1c1
Sequence:CCGGCCCTAACAACTGAATTGAGAACTCGAGTTCTCAATTCAGTTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1253s1c1
Sequence:CCGGGCCTGGAAAGGTACTATTTATCTCGAGATAAATAGTACCTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138758.1-155s21c1
Sequence:CCGGACAAAGCAGGCTCCGTAATTTCTCGAGAAATTACGGAGCCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1396s21c1
Sequence:CCGGATCGAAAGTGCTAGGATTATGCTCGAGCATAATCCTAGCACTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1252s21c1
Sequence:CCGGAGCCTGGAAAGGTACTATTTACTCGAGTAAATAGTACCTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1229s1c1
Sequence:CCGGGAATGAGCTTTGGGTCAAATTCTCGAGAATTTGACCCAAAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-369s21c1
Sequence:CCGGCGCTCAGCATCATGCTATAATCTCGAGATTATAGCATGATGCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1228s21c1
Sequence:CCGGAGAATGAGCTTTGGGTCAAATCTCGAGATTTGACCCAAAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138758
VALIDATED
TMLHE MISSION shRNA shRNA Plasmid DNA
trimethyllysine hydroxylase, epsilon
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1254s1c1
Sequence:CCGGCCTGGAAAGGTACTATTTATACTCGAGTATAAATAGTACCTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1201s1c1
Sequence:CCGGCCCTAACAACTGAATTGAGAACTCGAGTTCTCAATTCAGTTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1253s1c1
Sequence:CCGGGCCTGGAAAGGTACTATTTATCTCGAGATAAATAGTACCTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138758.1-155s21c1
Sequence:CCGGACAAAGCAGGCTCCGTAATTTCTCGAGAAATTACGGAGCCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1396s21c1
Sequence:CCGGATCGAAAGTGCTAGGATTATGCTCGAGCATAATCCTAGCACTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1252s21c1
Sequence:CCGGAGCCTGGAAAGGTACTATTTACTCGAGTAAATAGTACCTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1229s1c1
Sequence:CCGGGAATGAGCTTTGGGTCAAATTCTCGAGAATTTGACCCAAAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-369s21c1
Sequence:CCGGCGCTCAGCATCATGCTATAATCTCGAGATTATAGCATGATGCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1228s21c1
Sequence:CCGGAGAATGAGCTTTGGGTCAAATCTCGAGATTTGACCCAAAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138758
VALIDATED
TMLHE MISSION shRNA Lentiviral Transduction Particles
trimethyllysine hydroxylase, epsilon
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1254s1c1
Sequence:CCGGCCTGGAAAGGTACTATTTATACTCGAGTATAAATAGTACCTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1201s1c1
Sequence:CCGGCCCTAACAACTGAATTGAGAACTCGAGTTCTCAATTCAGTTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1253s1c1
Sequence:CCGGGCCTGGAAAGGTACTATTTATCTCGAGATAAATAGTACCTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138758.1-155s21c1
Sequence:CCGGACAAAGCAGGCTCCGTAATTTCTCGAGAAATTACGGAGCCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1396s21c1
Sequence:CCGGATCGAAAGTGCTAGGATTATGCTCGAGCATAATCCTAGCACTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1252s21c1
Sequence:CCGGAGCCTGGAAAGGTACTATTTACTCGAGTAAATAGTACCTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138758.1-1229s1c1
Sequence:CCGGGAATGAGCTTTGGGTCAAATTCTCGAGAATTTGACCCAAAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-369s21c1
Sequence:CCGGCGCTCAGCATCATGCTATAATCTCGAGATTATAGCATGATGCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138758.1-1228s21c1
Sequence:CCGGAGAATGAGCTTTGGGTCAAATCTCGAGATTTGACCCAAAGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018196
VALIDATED
TMLHE MISSION shRNA Bacterial Glycerol Stock
trimethyllysine hydroxylase, epsilon
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-354s1c1
Sequence:CCGGCGCTTTGATTACGTCTGGCTTCTCGAGAAGCCAGACGTAATCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-1214s1c1
Sequence:CCGGCCGGACTCTAACGATAGAGTTCTCGAGAACTCTATCGTTAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-462s1c1
Sequence:CCGGCCAAAGACCATTCGTCTGGATCTCGAGATCCAGACGAATGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018196.1-1019s1c1
Sequence:CCGGCCTCAGTAAAGTGCCATTGAACTCGAGTTCAATGGCACTTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-869s1c1
Sequence:CCGGGCACACTGACACTACCTATTTCTCGAGAAATAGGTAGTGTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018196
VALIDATED
TMLHE MISSION shRNA shRNA Plasmid DNA
trimethyllysine hydroxylase, epsilon
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-354s1c1
Sequence:CCGGCGCTTTGATTACGTCTGGCTTCTCGAGAAGCCAGACGTAATCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-1214s1c1
Sequence:CCGGCCGGACTCTAACGATAGAGTTCTCGAGAACTCTATCGTTAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-462s1c1
Sequence:CCGGCCAAAGACCATTCGTCTGGATCTCGAGATCCAGACGAATGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018196.1-1019s1c1
Sequence:CCGGCCTCAGTAAAGTGCCATTGAACTCGAGTTCAATGGCACTTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-869s1c1
Sequence:CCGGGCACACTGACACTACCTATTTCTCGAGAAATAGGTAGTGTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018196
VALIDATED
TMLHE MISSION shRNA Lentiviral Transduction Particles
trimethyllysine hydroxylase, epsilon
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-354s1c1
Sequence:CCGGCGCTTTGATTACGTCTGGCTTCTCGAGAAGCCAGACGTAATCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-1214s1c1
Sequence:CCGGCCGGACTCTAACGATAGAGTTCTCGAGAACTCTATCGTTAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-462s1c1
Sequence:CCGGCCAAAGACCATTCGTCTGGATCTCGAGATCCAGACGAATGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018196.1-1019s1c1
Sequence:CCGGCCTCAGTAAAGTGCCATTGAACTCGAGTTCAATGGCACTTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018196.1-869s1c1
Sequence:CCGGGCACACTGACACTACCTATTTCTCGAGAAATAGGTAGTGTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks