EMAIL THIS PAGE TO A FRIEND

TMOD1

tropomodulin 1

Synonyms: D9S57E ETMOD TMOD
UniProtKB ID: P28289, B2RB77, Q9BUF1
Gene ID:
Human(7111) Summary: This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(21916) tropomodulin 1
Rat(25566) tropomodulin 1
Zebrafish(100149766) tropomodulin 1
chicken(395883) tropomodulin 1
dog(474771) tropomodulin 1
domestic cat(101082350) tropomodulin 1
naked mole-rat(101696711) tropomodulin 1
cow(780784) tropomodulin 1
sheep(101104717) tropomodulin 1
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003275 Rosetta Predictions human pricing
NM_013044 Rosetta Predictions rat pricing
NM_021883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011216 predicted 617
2 SASI_Hs01_00011218 predicted 620
3 SASI_Hs01_00011219 predicted 305
4 SASI_Hs01_00011221 predicted 631
5 SASI_Hs01_00011222 predicted 260
6 SASI_Hs01_00011223 predicted 967
7 SASI_Hs02_00335334 predicted 915
8 SASI_Hs01_00011224 predicted 1129
9 SASI_Hs01_00011225 predicted 965
10 SASI_Hs02_00335335 predicted 934
11 SASI_Hs01_00011217 predicted 528
12 SASI_Hs01_00011220 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061432 predicted 665
2 SASI_Rn01_00061433 predicted 364
3 SASI_Rn02_00260768 predicted 680
4 SASI_Rn01_00061434 predicted 678
5 SASI_Rn02_00260769 predicted 790
6 SASI_Rn01_00061435 predicted 1257
7 SASI_Rn01_00061437 predicted 463
8 SASI_Rn01_00061438 predicted 1022
9 SASI_Rn01_00061439 predicted 469
10 SASI_Rn01_00061440 predicted 695
11 SASI_Rn01_00061436 predicted 802
12 SASI_Rn01_00061441 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150877 predicted 750
2 SASI_Mm01_00150878 predicted 704
3 SASI_Mm02_00326444 predicted 1402
4 SASI_Mm01_00150879 predicted 724
5 SASI_Mm01_00150880 predicted 626
6 SASI_Mm01_00150881 predicted 1069
7 SASI_Mm01_00150882 predicted 722
8 SASI_Mm01_00150883 predicted 838
9 SASI_Mm01_00150884 predicted 360
10 SASI_Mm01_00150885 predicted 843
11 SASI_Mm01_00150886 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003275
VALIDATED
TMOD1 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003275.2-587s21c1
Sequence:CCGGGAAACGCTGGAACGGATAAAGCTCGAGCTTTATCCGTTCCAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003275.2-512s21c1
Sequence:CCGGGGGCTCAACAGCGTGATTAAACTCGAGTTTAATCACGCTGTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003275.2-553s21c1
Sequence:CCGGGCCCGACGAAGAACCAAATTCCTCGAGGAATTTGGTTCTTCGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003275.2-1320s21c1
Sequence:CCGGGAAGTTGAATCTGGTTATTATCTCGAGATAATAACCAGATTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003275.2-638s21c1
Sequence:CCGGCTCAATAATATCCGGAATATCCTCGAGGATATTCCGGATATTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-522s1c1
Sequence:CCGGGCGTGATTAAACCCACACAATCTCGAGATTGTGTGGGTTTAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-555s1c1
Sequence:CCGGCCGACGAAGAACCAAATTCAACTCGAGTTGAATTTGGTTCTTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-521s1c1
Sequence:CCGGAGCGTGATTAAACCCACACAACTCGAGTTGTGTGGGTTTAATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-637s1c1
Sequence:CCGGCCTCAATAATATCCGGAATATCTCGAGATATTCCGGATATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003275.1-1599s1c1
Sequence:CCGGCCTCGATTAAAGTTGCCAAATCTCGAGATTTGGCAACTTTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003275
VALIDATED
TMOD1 MISSION shRNA shRNA Plasmid DNA
tropomodulin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003275.2-587s21c1
Sequence:CCGGGAAACGCTGGAACGGATAAAGCTCGAGCTTTATCCGTTCCAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003275.2-512s21c1
Sequence:CCGGGGGCTCAACAGCGTGATTAAACTCGAGTTTAATCACGCTGTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003275.2-553s21c1
Sequence:CCGGGCCCGACGAAGAACCAAATTCCTCGAGGAATTTGGTTCTTCGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003275.2-1320s21c1
Sequence:CCGGGAAGTTGAATCTGGTTATTATCTCGAGATAATAACCAGATTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003275.2-638s21c1
Sequence:CCGGCTCAATAATATCCGGAATATCCTCGAGGATATTCCGGATATTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-522s1c1
Sequence:CCGGGCGTGATTAAACCCACACAATCTCGAGATTGTGTGGGTTTAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-555s1c1
Sequence:CCGGCCGACGAAGAACCAAATTCAACTCGAGTTGAATTTGGTTCTTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-521s1c1
Sequence:CCGGAGCGTGATTAAACCCACACAACTCGAGTTGTGTGGGTTTAATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-637s1c1
Sequence:CCGGCCTCAATAATATCCGGAATATCTCGAGATATTCCGGATATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003275.1-1599s1c1
Sequence:CCGGCCTCGATTAAAGTTGCCAAATCTCGAGATTTGGCAACTTTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003275
VALIDATED
TMOD1 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003275.2-587s21c1
Sequence:CCGGGAAACGCTGGAACGGATAAAGCTCGAGCTTTATCCGTTCCAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003275.2-512s21c1
Sequence:CCGGGGGCTCAACAGCGTGATTAAACTCGAGTTTAATCACGCTGTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003275.2-553s21c1
Sequence:CCGGGCCCGACGAAGAACCAAATTCCTCGAGGAATTTGGTTCTTCGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003275.2-1320s21c1
Sequence:CCGGGAAGTTGAATCTGGTTATTATCTCGAGATAATAACCAGATTCAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003275.2-638s21c1
Sequence:CCGGCTCAATAATATCCGGAATATCCTCGAGGATATTCCGGATATTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-522s1c1
Sequence:CCGGGCGTGATTAAACCCACACAATCTCGAGATTGTGTGGGTTTAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-555s1c1
Sequence:CCGGCCGACGAAGAACCAAATTCAACTCGAGTTGAATTTGGTTCTTCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-521s1c1
Sequence:CCGGAGCGTGATTAAACCCACACAACTCGAGTTGTGTGGGTTTAATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003275.1-637s1c1
Sequence:CCGGCCTCAATAATATCCGGAATATCTCGAGATATTCCGGATATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003275.1-1599s1c1
Sequence:CCGGCCTCGATTAAAGTTGCCAAATCTCGAGATTTGGCAACTTTAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021883
VALIDATED
TMOD1 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-1320s1c1
Sequence:CCGGGCACAGAAGTTCAGTCTGGTACTCGAGTACCAGACTGAACTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-631s1c1
Sequence:CCGGCCCAGAACTAGAAGAGGTTAACTCGAGTTAACCTCTTCTAGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-910s1c1
Sequence:CCGGCGATAACCAGAGCCAACCTTTCTCGAGAAAGGTTGGCTCTGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-630s1c1
Sequence:CCGGACCCAGAACTAGAAGAGGTTACTCGAGTAACCTCTTCTAGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-152s1c1
Sequence:CCGGGATGAACTAGACCCTGATAATCTCGAGATTATCAGGGTCTAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021883
VALIDATED
TMOD1 MISSION shRNA shRNA Plasmid DNA
tropomodulin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-1320s1c1
Sequence:CCGGGCACAGAAGTTCAGTCTGGTACTCGAGTACCAGACTGAACTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-631s1c1
Sequence:CCGGCCCAGAACTAGAAGAGGTTAACTCGAGTTAACCTCTTCTAGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-910s1c1
Sequence:CCGGCGATAACCAGAGCCAACCTTTCTCGAGAAAGGTTGGCTCTGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-630s1c1
Sequence:CCGGACCCAGAACTAGAAGAGGTTACTCGAGTAACCTCTTCTAGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-152s1c1
Sequence:CCGGGATGAACTAGACCCTGATAATCTCGAGATTATCAGGGTCTAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021883
VALIDATED
TMOD1 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-1320s1c1
Sequence:CCGGGCACAGAAGTTCAGTCTGGTACTCGAGTACCAGACTGAACTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-631s1c1
Sequence:CCGGCCCAGAACTAGAAGAGGTTAACTCGAGTTAACCTCTTCTAGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-910s1c1
Sequence:CCGGCGATAACCAGAGCCAACCTTTCTCGAGAAAGGTTGGCTCTGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-630s1c1
Sequence:CCGGACCCAGAACTAGAAGAGGTTACTCGAGTAACCTCTTCTAGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021883.1-152s1c1
Sequence:CCGGGATGAACTAGACCCTGATAATCTCGAGATTATCAGGGTCTAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks