EMAIL THIS PAGE TO A FRIEND

TMOD2

tropomodulin 2 (neuronal)

Synonyms: N-TMOD NTMOD
UniProtKB ID: Q9NZR1, B4DEW6
Gene ID:
Human(29767) Summary: This gene encodes a neuronal-specific member of the tropomodulin family of actin-regulatory proteins. The encoded protein caps the pointed end of actin filaments preventing both elongation and depolymerization. The capping activity of this protein is dependent on its association with tropomyosin. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
Mouse(50876) tropomodulin 2
Rat(58814) tropomodulin 2
cow(532085) tropomodulin 2 (neuronal)
sheep(101104240) tropomodulin 2 (neuronal)
domestic guinea pig(100722174) tropomodulin 2 (neuronal)
naked mole-rat(101702934) tropomodulin 2 (neuronal)
Domestic Rabbit(100339581) tropomodulin 2 (neuronal)
Zebrafish(447869) tropomodulin 2
dog(478309) tropomodulin 2 (neuronal)
chicken(415422) tropomodulin 2 (neuronal)
Horse(100055095) tropomodulin 2 (neuronal)
domestic cat(101094022) tropomodulin 2 (neuronal)
Gene Class: Cytoskeleton
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014548 Rosetta Predictions human pricing
NM_031613 Rosetta Predictions rat pricing
NM_001038710 Rosetta Predictions mouse pricing
NM_016711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096164 predicted 312
2 SASI_Hs02_00345811 predicted 1222
3 SASI_Hs01_00096165 predicted 881
4 SASI_Hs01_00096167 predicted 1108
5 SASI_Hs01_00096168 predicted 1315
6 SASI_Hs01_00096169 predicted 1313
7 SASI_Hs01_00096170 predicted 916
8 SASI_Hs01_00096171 predicted 414
9 SASI_Hs01_00096172 predicted 1309
10 SASI_Hs01_00096173 predicted 873
11 SASI_Hs01_00096166 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073096 predicted 790
2 SASI_Rn01_00073097 predicted 207
3 SASI_Rn01_00073098 predicted 340
4 SASI_Rn01_00073099 predicted 662
5 SASI_Rn01_00073100 predicted 822
6 SASI_Rn01_00073101 predicted 548
7 SASI_Rn01_00073102 predicted 726
8 SASI_Rn01_00073103 predicted 334
9 SASI_Rn01_00073104 predicted 469
10 SASI_Rn01_00073105 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090670 predicted 1199
2 SASI_Mm01_00090672 predicted 1069
3 SASI_Mm01_00090673 predicted 1037
4 SASI_Mm01_00090674 predicted 1589
5 SASI_Mm01_00090675 predicted 922
6 SASI_Mm02_00289698 predicted 922
7 SASI_Mm01_00090676 predicted 1563
8 SASI_Mm01_00090677 predicted 685
9 SASI_Mm01_00090678 predicted 1369
10 SASI_Mm02_00289699 predicted 1371
11 SASI_Mm01_00090669 predicted 1094
12 SASI_Mm01_00090671 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114694 predicted 1135
2 SASI_Mm01_00114696 predicted 1007
3 SASI_Mm01_00114697 predicted 969
4 SASI_Mm01_00114698 predicted 1518
5 SASI_Mm01_00114699 predicted 856
6 SASI_Mm02_00323400 predicted 855
7 SASI_Mm01_00114700 predicted 1496
8 SASI_Mm01_00114701 predicted 618
9 SASI_Mm01_00114702 predicted 1303
10 SASI_Mm02_00323401 predicted 1312
11 SASI_Mm01_00114693 predicted 1021
12 SASI_Mm01_00114695 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016711
TMOD2 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 2 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-352s1c1
Sequence:CCGGCCTGCTGGATTCCGACAGAAACTCGAGTTTCTGTCGGAATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-986s1c1
Sequence:CCGGGTCTAAACGTAGAGTCCAATTCTCGAGAATTGGACTCTACGTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-822s1c1
Sequence:CCGGCCTCAACAACATTAAGAACATCTCGAGATGTTCTTAATGTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-697s1c1
Sequence:CCGGCCTGTGAGGAATGTCGTGAAACTCGAGTTTCACGACATTCCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-1234s1c1
Sequence:CCGGGTTCGAAAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016711
TMOD2 MISSION shRNA shRNA Plasmid DNA
tropomodulin 2 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-352s1c1
Sequence:CCGGCCTGCTGGATTCCGACAGAAACTCGAGTTTCTGTCGGAATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-986s1c1
Sequence:CCGGGTCTAAACGTAGAGTCCAATTCTCGAGAATTGGACTCTACGTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-822s1c1
Sequence:CCGGCCTCAACAACATTAAGAACATCTCGAGATGTTCTTAATGTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-697s1c1
Sequence:CCGGCCTGTGAGGAATGTCGTGAAACTCGAGTTTCACGACATTCCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-1234s1c1
Sequence:CCGGGTTCGAAAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016711
TMOD2 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 2 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-352s1c1
Sequence:CCGGCCTGCTGGATTCCGACAGAAACTCGAGTTTCTGTCGGAATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-986s1c1
Sequence:CCGGGTCTAAACGTAGAGTCCAATTCTCGAGAATTGGACTCTACGTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-822s1c1
Sequence:CCGGCCTCAACAACATTAAGAACATCTCGAGATGTTCTTAATGTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-697s1c1
Sequence:CCGGCCTGTGAGGAATGTCGTGAAACTCGAGTTTCACGACATTCCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016711.2-1234s1c1
Sequence:CCGGGTTCGAAAGAAGAGAGTTGAACTCGAGTTCAACTCTCTTCTTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014548
TMOD2 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 2 (neuronal)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-916s1c1
Sequence:CCGGGCTGAAAGTAAACAAGACCTTCTCGAGAAGGTCTTGTTTACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-249s1c1
Sequence:CCGGAGGAACTGAAACAGTTGGAAACTCGAGTTTCCAACTGTTTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-629s1c1
Sequence:CCGGGCCAACAATAAAGGTGGCAAACTCGAGTTTGCCACCTTTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-653s1c1
Sequence:CCGGCCTGTCAGAAATGTTGTCAAACTCGAGTTTGACAACATTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-308s1c1
Sequence:CCGGCCAGCTGGATTTCGACAGAAACTCGAGTTTCTGTCGAAATCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014548.3-1729s21c1
Sequence:CCGGAGTTAGTATTGCCAATCTTTCCTCGAGGAAAGATTGGCAATACTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014548.3-529s21c1
Sequence:CCGGAGCCTATAGAAACTCGTAAAGCTCGAGCTTTACGAGTTTCTATAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014548.3-1379s21c1
Sequence:CCGGTCCGTTAACCACATAACTAATCTCGAGATTAGTTATGTGGTTAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014548
TMOD2 MISSION shRNA shRNA Plasmid DNA
tropomodulin 2 (neuronal)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-916s1c1
Sequence:CCGGGCTGAAAGTAAACAAGACCTTCTCGAGAAGGTCTTGTTTACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-249s1c1
Sequence:CCGGAGGAACTGAAACAGTTGGAAACTCGAGTTTCCAACTGTTTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-629s1c1
Sequence:CCGGGCCAACAATAAAGGTGGCAAACTCGAGTTTGCCACCTTTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-653s1c1
Sequence:CCGGCCTGTCAGAAATGTTGTCAAACTCGAGTTTGACAACATTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-308s1c1
Sequence:CCGGCCAGCTGGATTTCGACAGAAACTCGAGTTTCTGTCGAAATCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014548.3-1729s21c1
Sequence:CCGGAGTTAGTATTGCCAATCTTTCCTCGAGGAAAGATTGGCAATACTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014548.3-529s21c1
Sequence:CCGGAGCCTATAGAAACTCGTAAAGCTCGAGCTTTACGAGTTTCTATAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014548.3-1379s21c1
Sequence:CCGGTCCGTTAACCACATAACTAATCTCGAGATTAGTTATGTGGTTAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014548
TMOD2 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 2 (neuronal)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-916s1c1
Sequence:CCGGGCTGAAAGTAAACAAGACCTTCTCGAGAAGGTCTTGTTTACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-249s1c1
Sequence:CCGGAGGAACTGAAACAGTTGGAAACTCGAGTTTCCAACTGTTTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-629s1c1
Sequence:CCGGGCCAACAATAAAGGTGGCAAACTCGAGTTTGCCACCTTTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-653s1c1
Sequence:CCGGCCTGTCAGAAATGTTGTCAAACTCGAGTTTGACAACATTTCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014548.2-308s1c1
Sequence:CCGGCCAGCTGGATTTCGACAGAAACTCGAGTTTCTGTCGAAATCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014548.3-1729s21c1
Sequence:CCGGAGTTAGTATTGCCAATCTTTCCTCGAGGAAAGATTGGCAATACTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014548.3-529s21c1
Sequence:CCGGAGCCTATAGAAACTCGTAAAGCTCGAGCTTTACGAGTTTCTATAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014548.3-1379s21c1
Sequence:CCGGTCCGTTAACCACATAACTAATCTCGAGATTAGTTATGTGGTTAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks