EMAIL THIS PAGE TO A FRIEND

TMOD3

tropomodulin 3 (ubiquitous)

Synonyms: UTMOD
UniProtKB ID: Q9NYL9, B2R6G7, Q9NT43, Q9NZR0
Gene ID:
Mouse(50875) tropomodulin 3
Rat(300838) tropomodulin 3
chicken(415421) tropomodulin 3 (ubiquitous)
dog(487554) tropomodulin 3 (ubiquitous)
domestic cat(101093777) tropomodulin 3 (ubiquitous)
Horse(100069657) tropomodulin 3 (ubiquitous)
naked mole-rat(101702107) tropomodulin 3 (ubiquitous)
domestic guinea pig(100718496) tropomodulin 3 (ubiquitous)
cow(533257) tropomodulin 3 (ubiquitous)
sheep(101103980) tropomodulin 3 (ubiquitous)
Gene Class: Cytoskeleton
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014547 Rosetta Predictions human pricing
NM_001011997 Rosetta Predictions rat pricing
NM_016963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195987 predicted 929
2 SASI_Hs02_00345808 predicted 741
3 SASI_Hs01_00195988 predicted 775
4 SASI_Hs02_00345809 predicted 1043
5 SASI_Hs01_00195989 predicted 888
6 SASI_Hs01_00195990 predicted 987
7 SASI_Hs01_00195991 predicted 877
8 SASI_Hs01_00195992 predicted 775
9 SASI_Hs01_00195995 predicted 247
10 SASI_Hs02_00345810 predicted 750
11 SASI_Hs01_00195986 predicted 1166
12 SASI_Hs01_00195993 predicted 827
13 SASI_Hs01_00195994 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084718 predicted 921
2 SASI_Rn01_00084719 predicted 834
3 SASI_Rn01_00084720 predicted 473
4 SASI_Rn01_00084721 predicted 678
5 SASI_Rn01_00084722 predicted 850
6 SASI_Rn01_00084723 predicted 410
7 SASI_Rn01_00084724 predicted 623
8 SASI_Rn01_00084725 predicted 416
9 SASI_Rn01_00084726 predicted 1009
10 SASI_Rn01_00084727 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183061 predicted 958
2 SASI_Mm01_00183062 predicted 1015
3 SASI_Mm01_00183064 predicted 968
4 SASI_Mm01_00183065 predicted 750
5 SASI_Mm01_00183066 predicted 596
6 SASI_Mm01_00183067 predicted 1197
7 SASI_Mm01_00183068 predicted 762
8 SASI_Mm01_00183069 predicted 596
9 SASI_Mm01_00183070 predicted 547
10 SASI_Mm02_00323814 predicted 558
11 SASI_Mm01_00183063 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014547
VALIDATED
TMOD3 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 3 (ubiquitous)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1623s21c1
Sequence:CCGGTGCTGGTATCAGAATTGTTATCTCGAGATAACAATTCTGATACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1329s21c1
Sequence:CCGGATGTTGGTGACATCATGTAAACTCGAGTTTACATGATGTCACCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1583s21c1
Sequence:CCGGACATTGTGAGGACCAATCTTTCTCGAGAAAGATTGGTCCTCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-639s21c1
Sequence:CCGGGCACAATTTGATAACGAATACCTCGAGGTATTCGTTATCAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-1076s21c1
Sequence:CCGGCAGAGCTCAAGATTGACAATCCTCGAGGATTGTCAATCTTGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-1276s21c1
Sequence:CCGGTAAGTCTGCAAAGGTGTAATCCTCGAGGATTACACCTTTGCAGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-671s21c1
Sequence:CCGGATATAATGGGAAGTAGTAATGCTCGAGCATTACTACTTCCCATTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014547.3-1928s1c1
Sequence:CCGGGCCAGGTTACATACTTTATTTCTCGAGAAATAAAGTATGTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-1205s1c1
Sequence:CCGGCCAGAGCAGCTAATGCTATAACTCGAGTTATAGCATTAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-1208s1c1
Sequence:CCGGGAGCAGCTAATGCTATAACAACTCGAGTTGTTATAGCATTAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-811s1c1
Sequence:CCGGGCTCATCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-743s1c1
Sequence:CCGGCGGTATTTGATGAGCCACCAACTCGAGTTGGTGGCTCATCAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014547
VALIDATED
TMOD3 MISSION shRNA shRNA Plasmid DNA
tropomodulin 3 (ubiquitous)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1623s21c1
Sequence:CCGGTGCTGGTATCAGAATTGTTATCTCGAGATAACAATTCTGATACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1329s21c1
Sequence:CCGGATGTTGGTGACATCATGTAAACTCGAGTTTACATGATGTCACCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1583s21c1
Sequence:CCGGACATTGTGAGGACCAATCTTTCTCGAGAAAGATTGGTCCTCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-639s21c1
Sequence:CCGGGCACAATTTGATAACGAATACCTCGAGGTATTCGTTATCAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-1076s21c1
Sequence:CCGGCAGAGCTCAAGATTGACAATCCTCGAGGATTGTCAATCTTGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-1276s21c1
Sequence:CCGGTAAGTCTGCAAAGGTGTAATCCTCGAGGATTACACCTTTGCAGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-671s21c1
Sequence:CCGGATATAATGGGAAGTAGTAATGCTCGAGCATTACTACTTCCCATTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014547.3-1928s1c1
Sequence:CCGGGCCAGGTTACATACTTTATTTCTCGAGAAATAAAGTATGTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-1205s1c1
Sequence:CCGGCCAGAGCAGCTAATGCTATAACTCGAGTTATAGCATTAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-1208s1c1
Sequence:CCGGGAGCAGCTAATGCTATAACAACTCGAGTTGTTATAGCATTAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-811s1c1
Sequence:CCGGGCTCATCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-743s1c1
Sequence:CCGGCGGTATTTGATGAGCCACCAACTCGAGTTGGTGGCTCATCAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014547
VALIDATED
TMOD3 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 3 (ubiquitous)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1623s21c1
Sequence:CCGGTGCTGGTATCAGAATTGTTATCTCGAGATAACAATTCTGATACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1329s21c1
Sequence:CCGGATGTTGGTGACATCATGTAAACTCGAGTTTACATGATGTCACCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014547.3-1583s21c1
Sequence:CCGGACATTGTGAGGACCAATCTTTCTCGAGAAAGATTGGTCCTCACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-639s21c1
Sequence:CCGGGCACAATTTGATAACGAATACCTCGAGGTATTCGTTATCAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-1076s21c1
Sequence:CCGGCAGAGCTCAAGATTGACAATCCTCGAGGATTGTCAATCTTGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-1276s21c1
Sequence:CCGGTAAGTCTGCAAAGGTGTAATCCTCGAGGATTACACCTTTGCAGACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014547.3-671s21c1
Sequence:CCGGATATAATGGGAAGTAGTAATGCTCGAGCATTACTACTTCCCATTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014547.3-1928s1c1
Sequence:CCGGGCCAGGTTACATACTTTATTTCTCGAGAAATAAAGTATGTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-1205s1c1
Sequence:CCGGCCAGAGCAGCTAATGCTATAACTCGAGTTATAGCATTAGCTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-1208s1c1
Sequence:CCGGGAGCAGCTAATGCTATAACAACTCGAGTTGTTATAGCATTAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-811s1c1
Sequence:CCGGGCTCATCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014547.3-743s1c1
Sequence:CCGGCGGTATTTGATGAGCCACCAACTCGAGTTGGTGGCTCATCAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016963
VALIDATED
TMOD3 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 3 (ubiquitous)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-513s21c1
Sequence:CCGGCGCAGACTCTTACAGAAGAAACTCGAGTTTCTTCTGTAAGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016963.2-1877s21c1
Sequence:CCGGCCCACTGCATACCTTGTTAAACTCGAGTTTAACAAGGTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-791s21c1
Sequence:CCGGGCCCGTCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-403s21c1
Sequence:CCGGGCTCCTTTCTTACCTAGAGAACTCGAGTTCTCTAGGTAAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-1792s1c1
Sequence:CCGGCCCACTGCATACCTTGTTAAACTCGAGTTTAACAAGGTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-427s1c1
Sequence:CCGGCGCAGACTCTTACAGAAGAAACTCGAGTTTCTTCTGTAAGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-317s1c1
Sequence:CCGGGCTCCTTTCTTACCTAGAGAACTCGAGTTCTCTAGGTAAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-705s1c1
Sequence:CCGGGCCCGTCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-706s1c1
Sequence:CCGGCCCGTCTTGTTGAAGTTAATTCTCGAGAATTAACTTCAACAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016963
VALIDATED
TMOD3 MISSION shRNA shRNA Plasmid DNA
tropomodulin 3 (ubiquitous)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-513s21c1
Sequence:CCGGCGCAGACTCTTACAGAAGAAACTCGAGTTTCTTCTGTAAGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016963.2-1877s21c1
Sequence:CCGGCCCACTGCATACCTTGTTAAACTCGAGTTTAACAAGGTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-791s21c1
Sequence:CCGGGCCCGTCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-403s21c1
Sequence:CCGGGCTCCTTTCTTACCTAGAGAACTCGAGTTCTCTAGGTAAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-1792s1c1
Sequence:CCGGCCCACTGCATACCTTGTTAAACTCGAGTTTAACAAGGTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-427s1c1
Sequence:CCGGCGCAGACTCTTACAGAAGAAACTCGAGTTTCTTCTGTAAGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-317s1c1
Sequence:CCGGGCTCCTTTCTTACCTAGAGAACTCGAGTTCTCTAGGTAAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-705s1c1
Sequence:CCGGGCCCGTCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-706s1c1
Sequence:CCGGCCCGTCTTGTTGAAGTTAATTCTCGAGAATTAACTTCAACAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016963
VALIDATED
TMOD3 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 3 (ubiquitous)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-513s21c1
Sequence:CCGGCGCAGACTCTTACAGAAGAAACTCGAGTTTCTTCTGTAAGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016963.2-1877s21c1
Sequence:CCGGCCCACTGCATACCTTGTTAAACTCGAGTTTAACAAGGTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-791s21c1
Sequence:CCGGGCCCGTCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016963.2-403s21c1
Sequence:CCGGGCTCCTTTCTTACCTAGAGAACTCGAGTTCTCTAGGTAAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-1792s1c1
Sequence:CCGGCCCACTGCATACCTTGTTAAACTCGAGTTTAACAAGGTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-427s1c1
Sequence:CCGGCGCAGACTCTTACAGAAGAAACTCGAGTTTCTTCTGTAAGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-317s1c1
Sequence:CCGGGCTCCTTTCTTACCTAGAGAACTCGAGTTCTCTAGGTAAGAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-705s1c1
Sequence:CCGGGCCCGTCTTGTTGAAGTTAATCTCGAGATTAACTTCAACAAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016963.1-706s1c1
Sequence:CCGGCCCGTCTTGTTGAAGTTAATTCTCGAGAATTAACTTCAACAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks