EMAIL THIS PAGE TO A FRIEND

TMOD4

tropomodulin 4 (muscle)

Synonyms: SK-TMOD
UniProtKB ID: Q9NZQ9, Q5JR83, Q8WVL3, Q9UKH2
Gene ID:
Mouse(50874) tropomodulin 4
Rat(295261) tropomodulin 4
cow(505645) tropomodulin 4 (muscle)
sheep(101113115) tropomodulin 4 (muscle)
domestic guinea pig(100734866) tropomodulin 4 (muscle)
naked mole-rat(101706507) tropomodulin 4 (muscle)
Domestic Rabbit(100328666) tropomodulin 4 (muscle)
Zebrafish(30441) tropomodulin 4 (muscle)
chicken(395547) tropomodulin 4 (muscle)
dog(483194) tropomodulin 4 (muscle)
domestic cat(101097505) tropomodulin 4 (muscle)
Gene Class: Cytoskeleton
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013353 Rosetta Predictions human pricing
NM_001106449 Rosetta Predictions rat pricing
NM_016712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038408 predicted 585
2 SASI_Hs02_00344674 predicted 604
3 SASI_Hs01_00038409 predicted 610
4 SASI_Hs01_00038410 predicted 726
5 SASI_Hs01_00038412 predicted 550
6 SASI_Hs01_00038413 predicted 960
7 SASI_Hs01_00038414 predicted 427
8 SASI_Hs01_00038415 predicted 838
9 SASI_Hs01_00038416 predicted 820
10 SASI_Hs02_00344675 predicted 919
11 SASI_Hs01_00038411 predicted 913
12 SASI_Hs01_00038417 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219068 predicted 290
2 SASI_Rn02_00219069 predicted 414
3 SASI_Rn02_00219070 predicted 565
4 SASI_Rn02_00219071 predicted 790
5 SASI_Rn02_00219072 predicted 503
6 SASI_Rn02_00219073 predicted 348
7 SASI_Rn02_00219074 predicted 882
8 SASI_Rn02_00219075 predicted 475
9 SASI_Rn02_00219076 predicted 574
10 SASI_Rn02_00219077 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177213 predicted 384
2 SASI_Mm02_00323402 predicted 256
3 SASI_Mm01_00177215 predicted 568
4 SASI_Mm01_00177216 predicted 913
5 SASI_Mm02_00323403 predicted 796
6 SASI_Mm01_00177217 predicted 721
7 SASI_Mm01_00177218 predicted 656
8 SASI_Mm02_00323404 predicted 846
9 SASI_Mm01_00177220 predicted 348
10 SASI_Mm01_00177221 predicted 875
11 SASI_Mm01_00177214 predicted 555
12 SASI_Mm01_00177219 predicted 660
13 SASI_Mm01_00177222 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013353
TMOD4 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 4 (muscle)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-605s1c1
Sequence:CCGGCCCACAAACATTGAGGAGATACTCGAGTATCTCCTCAATGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-487s1c1
Sequence:CCGGGATGAGTAACAAGCAATACTACTCGAGTAGTATTGCTTGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-1054s1c1
Sequence:CCGGCCAGGCCATGACCCGAAACAACTCGAGTTGTTTCGGGTCATGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-296s1c1
Sequence:CCGGCTAGAAGTCAAAGAGCGTGATCTCGAGATCACGCTCTTTGACTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-832s1c1
Sequence:CCGGGAGCCTAAACATCGAATCCAACTCGAGTTGGATTCGATGTTTAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013353.2-840s21c1
Sequence:CCGGGTGAGGCAATGAAGGCAAATACTCGAGTATTTGCCTTCATTGCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013353.2-782s21c1
Sequence:CCGGGAGGAGGTGAACTTGAATAATCTCGAGATTATTCAAGTTCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013353
TMOD4 MISSION shRNA shRNA Plasmid DNA
tropomodulin 4 (muscle)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-605s1c1
Sequence:CCGGCCCACAAACATTGAGGAGATACTCGAGTATCTCCTCAATGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-487s1c1
Sequence:CCGGGATGAGTAACAAGCAATACTACTCGAGTAGTATTGCTTGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-1054s1c1
Sequence:CCGGCCAGGCCATGACCCGAAACAACTCGAGTTGTTTCGGGTCATGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-296s1c1
Sequence:CCGGCTAGAAGTCAAAGAGCGTGATCTCGAGATCACGCTCTTTGACTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-832s1c1
Sequence:CCGGGAGCCTAAACATCGAATCCAACTCGAGTTGGATTCGATGTTTAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013353.2-840s21c1
Sequence:CCGGGTGAGGCAATGAAGGCAAATACTCGAGTATTTGCCTTCATTGCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013353.2-782s21c1
Sequence:CCGGGAGGAGGTGAACTTGAATAATCTCGAGATTATTCAAGTTCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013353
TMOD4 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 4 (muscle)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-605s1c1
Sequence:CCGGCCCACAAACATTGAGGAGATACTCGAGTATCTCCTCAATGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-487s1c1
Sequence:CCGGGATGAGTAACAAGCAATACTACTCGAGTAGTATTGCTTGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-1054s1c1
Sequence:CCGGCCAGGCCATGACCCGAAACAACTCGAGTTGTTTCGGGTCATGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-296s1c1
Sequence:CCGGCTAGAAGTCAAAGAGCGTGATCTCGAGATCACGCTCTTTGACTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013353.1-832s1c1
Sequence:CCGGGAGCCTAAACATCGAATCCAACTCGAGTTGGATTCGATGTTTAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013353.2-840s21c1
Sequence:CCGGGTGAGGCAATGAAGGCAAATACTCGAGTATTTGCCTTCATTGCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013353.2-782s21c1
Sequence:CCGGGAGGAGGTGAACTTGAATAATCTCGAGATTATTCAAGTTCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016712
TMOD4 MISSION shRNA Bacterial Glycerol Stock
tropomodulin 4 (muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-523s1c1
Sequence:CCGGCCTGACAAGTATAAGCCAGTACTCGAGTACTGGCTTATACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-792s1c1
Sequence:CCGGCCTGAACATTGAGTCTAACTTCTCGAGAAGTTAGACTCAATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-310s1c1
Sequence:CCGGCCCTTTATTCAGCCTAAGAGACTCGAGTCTCTTAGGCTGAATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-627s1c1
Sequence:CCGGCCTCAATAATATCCAGGACATCTCGAGATGTCCTGGATATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-789s1c1
Sequence:CCGGGAGCCTGAACATTGAGTCTAACTCGAGTTAGACTCAATGTTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016712
TMOD4 MISSION shRNA shRNA Plasmid DNA
tropomodulin 4 (muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-523s1c1
Sequence:CCGGCCTGACAAGTATAAGCCAGTACTCGAGTACTGGCTTATACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-792s1c1
Sequence:CCGGCCTGAACATTGAGTCTAACTTCTCGAGAAGTTAGACTCAATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-310s1c1
Sequence:CCGGCCCTTTATTCAGCCTAAGAGACTCGAGTCTCTTAGGCTGAATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-627s1c1
Sequence:CCGGCCTCAATAATATCCAGGACATCTCGAGATGTCCTGGATATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-789s1c1
Sequence:CCGGGAGCCTGAACATTGAGTCTAACTCGAGTTAGACTCAATGTTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016712
TMOD4 MISSION shRNA Lentiviral Transduction Particles
tropomodulin 4 (muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-523s1c1
Sequence:CCGGCCTGACAAGTATAAGCCAGTACTCGAGTACTGGCTTATACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-792s1c1
Sequence:CCGGCCTGAACATTGAGTCTAACTTCTCGAGAAGTTAGACTCAATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-310s1c1
Sequence:CCGGCCCTTTATTCAGCCTAAGAGACTCGAGTCTCTTAGGCTGAATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-627s1c1
Sequence:CCGGCCTCAATAATATCCAGGACATCTCGAGATGTCCTGGATATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016712.1-789s1c1
Sequence:CCGGGAGCCTGAACATTGAGTCTAACTCGAGTTAGACTCAATGTTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks