EMAIL THIS PAGE TO A FRIEND

TMPO

thymopoietin

Synonyms: CMD1T LAP2 LEMD4 PRO0868 TP
UniProtKB ID: P42167, Q14861
Gene ID:
Human(7112) Summary: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
Mouse(21917) thymopoietin
Rat(25359) thymopoietin
cow(510267) thymopoietin
chicken(417923) thymopoietin
dog(482618) thymopoietin
208 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032283 Rosetta Predictions human pricing
NM_001032284 Rosetta Predictions human pricing
NM_003276 Rosetta Predictions human pricing
NM_012887 Rosetta Predictions rat pricing
NM_001080129 Rosetta Predictions mouse pricing
NM_001080130 Rosetta Predictions mouse pricing
NM_001080131 Rosetta Predictions mouse pricing
NM_001080132 Rosetta Predictions mouse pricing
NM_001080134 Rosetta Predictions mouse pricing
NM_011605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307864 predicted 1539
2 SASI_Hs01_00194053 predicted 788
3 SASI_Hs01_00194054 predicted 959
4 SASI_Hs01_00194055 predicted 1035
5 SASI_Hs01_00194057 predicted 859
6 SASI_Hs01_00194058 predicted 642
7 SASI_Hs01_00194059 predicted 752
8 SASI_Hs01_00194060 predicted 863
9 SASI_Hs02_00307865 predicted 1597
10 SASI_Hs01_00194061 predicted 904
11 SASI_Hs01_00194056 predicted 790
12 SASI_Hs01_00194062 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307866 predicted 1217
2 SASI_Hs01_00138695 predicted 786
3 SASI_Hs01_00138696 predicted 890
4 SASI_Hs01_00138698 predicted 858
5 SASI_Hs01_00138699 predicted 637
6 SASI_Hs01_00138700 predicted 757
7 SASI_Hs01_00138701 predicted 862
8 SASI_Hs01_00138702 predicted 872
9 SASI_Hs02_00307867 predicted 1272
10 SASI_Hs01_00138703 predicted 289
11 SASI_Hs01_00138694 predicted 895
12 SASI_Hs01_00138697 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335336 predicted 1936
2 SASI_Hs01_00243366 predicted 912
3 SASI_Hs01_00243367 predicted 1545
4 SASI_Hs01_00243368 predicted 2308
5 SASI_Hs02_00335337 predicted 721
6 SASI_Hs01_00243370 predicted 1621
7 SASI_Hs01_00243371 predicted 1627
8 SASI_Hs02_00335338 predicted 2002
9 SASI_Hs02_00335339 predicted 2272
10 SASI_Hs01_00243373 predicted 775
11 SASI_Hs01_00243365 predicted 1338
12 SASI_Hs01_00243369 predicted 612
13 SASI_Hs01_00243372 predicted 2326
14 SASI_Hs01_00243374 predicted 2063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094807 predicted 1396
2 SASI_Rn01_00094808 predicted 622
3 SASI_Rn01_00094809 predicted 774
4 SASI_Rn01_00094810 predicted 861
5 SASI_Rn01_00094811 predicted 1420
6 SASI_Rn01_00094812 predicted 924
7 SASI_Rn02_00260401 predicted 1221
8 SASI_Rn01_00094813 predicted 799
9 SASI_Rn02_00260402 predicted 1386
10 SASI_Rn01_00094816 predicted 714
11 SASI_Rn01_00094814 predicted 931
12 SASI_Rn01_00094815 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293323 predicted 310
2 SASI_Mm02_00293324 predicted 591
3 SASI_Mm02_00293325 predicted 598
4 SASI_Mm02_00293326 predicted 597
5 SASI_Mm02_00293327 predicted 533
6 SASI_Mm02_00293328 predicted 429
7 SASI_Mm02_00293329 predicted 584
8 SASI_Mm02_00293330 predicted 352
9 SASI_Mm02_00293331 predicted 444
10 SASI_Mm02_00293332 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293333 predicted 313
2 SASI_Mm02_00293334 predicted 596
3 SASI_Mm02_00293335 predicted 593
4 SASI_Mm02_00293336 predicted 600
5 SASI_Mm02_00293337 predicted 532
6 SASI_Mm02_00293338 predicted 426
7 SASI_Mm02_00293339 predicted 584
8 SASI_Mm02_00293340 predicted 351
9 SASI_Mm02_00293341 predicted 447
10 SASI_Mm02_00293342 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293343 predicted 311
2 SASI_Mm02_00293344 predicted 593
3 SASI_Mm02_00293345 predicted 599
4 SASI_Mm02_00293346 predicted 599
5 SASI_Mm02_00293347 predicted 525
6 SASI_Mm02_00293348 predicted 426
7 SASI_Mm02_00293349 predicted 587
8 SASI_Mm02_00293350 predicted 352
9 SASI_Mm02_00293351 predicted 447
10 SASI_Mm02_00293352 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293353 predicted 312
2 SASI_Mm02_00293354 predicted 594
3 SASI_Mm02_00293355 predicted 594
4 SASI_Mm02_00293356 predicted 593
5 SASI_Mm02_00293357 predicted 528
6 SASI_Mm02_00293358 predicted 421
7 SASI_Mm02_00293359 predicted 589
8 SASI_Mm02_00293360 predicted 352
9 SASI_Mm02_00293361 predicted 449
10 SASI_Mm02_00293362 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293363 predicted 312
2 SASI_Mm02_00293364 predicted 590
3 SASI_Mm02_00293365 predicted 594
4 SASI_Mm02_00293366 predicted 592
5 SASI_Mm02_00293367 predicted 530
6 SASI_Mm02_00293368 predicted 420
7 SASI_Mm02_00293369 predicted 590
8 SASI_Mm02_00293370 predicted 349
9 SASI_Mm02_00293371 predicted 449
10 SASI_Mm02_00293372 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321021 predicted 317
2 SASI_Mm01_00062779 predicted 591
3 SASI_Mm02_00321022 predicted 594
4 SASI_Mm02_00321023 predicted 601
5 SASI_Mm02_00321024 predicted 530
6 SASI_Mm02_00321025 predicted 428
7 SASI_Mm02_00321026 predicted 589
8 SASI_Mm02_00321027 predicted 350
9 SASI_Mm02_00321028 predicted 453
10 SASI_Mm02_00321029 predicted 348
11 SASI_Mm01_00062775 predicted 1343
12 SASI_Mm01_00062776 predicted 1989
13 SASI_Mm01_00062777 predicted 603
14 SASI_Mm01_00062778 predicted 689
15 SASI_Mm01_00062780 predicted 1463
16 SASI_Mm01_00062781 predicted 1441
17 SASI_Mm01_00062782 predicted 2077
18 SASI_Mm01_00062783 predicted 1560
19 SASI_Mm01_00062784 predicted 1911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003276
VALIDATED
TMPO MISSION shRNA Bacterial Glycerol Stock
thymopoietin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1293s21c1
Sequence:CCGGTGAGAGCTCACAACTAATTTCCTCGAGGAAATTAGTTGTGAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-611s21c1
Sequence:CCGGGAACAACCAGGAAGCTATATGCTCGAGCATATAGCTTCCTGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003276.1-2315s21c1
Sequence:CCGGATCTTATCTTTCAGGTACTTTCTCGAGAAAGTACCTGAAAGATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1226s21c1
Sequence:CCGGGTCCTGAGAGGTCCCATATTTCTCGAGAAATATGGGACCTCTCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1048s21c1
Sequence:CCGGTCTAGCCATGATAGGTGTTTACTCGAGTAAACACCTATCATGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003276.1-2326s1c1
Sequence:CCGGCAGGTACTTTATGCCAACATTCTCGAGAATGTTGGCATAAAGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003276.1-1783s1c1
Sequence:CCGGGCAACACAGATATTATCAGTTCTCGAGAACTGATAATATCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-1634s1c1
Sequence:CCGGCTAAGCAATCACAGCATGATACTCGAGTATCATGCTGTGATTGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-574s1c1
Sequence:CCGGCTTGTGAAATACGGAGTGAATCTCGAGATTCACTCCGTATTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-2005s1c1
Sequence:CCGGGCACAGATTCTTAGCTCAGATCTCGAGATCTGAGCTAAGAATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003276
VALIDATED
TMPO MISSION shRNA shRNA Plasmid DNA
thymopoietin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1293s21c1
Sequence:CCGGTGAGAGCTCACAACTAATTTCCTCGAGGAAATTAGTTGTGAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-611s21c1
Sequence:CCGGGAACAACCAGGAAGCTATATGCTCGAGCATATAGCTTCCTGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003276.1-2315s21c1
Sequence:CCGGATCTTATCTTTCAGGTACTTTCTCGAGAAAGTACCTGAAAGATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1226s21c1
Sequence:CCGGGTCCTGAGAGGTCCCATATTTCTCGAGAAATATGGGACCTCTCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1048s21c1
Sequence:CCGGTCTAGCCATGATAGGTGTTTACTCGAGTAAACACCTATCATGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003276.1-2326s1c1
Sequence:CCGGCAGGTACTTTATGCCAACATTCTCGAGAATGTTGGCATAAAGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003276.1-1783s1c1
Sequence:CCGGGCAACACAGATATTATCAGTTCTCGAGAACTGATAATATCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-1634s1c1
Sequence:CCGGCTAAGCAATCACAGCATGATACTCGAGTATCATGCTGTGATTGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-574s1c1
Sequence:CCGGCTTGTGAAATACGGAGTGAATCTCGAGATTCACTCCGTATTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-2005s1c1
Sequence:CCGGGCACAGATTCTTAGCTCAGATCTCGAGATCTGAGCTAAGAATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003276
VALIDATED
TMPO MISSION shRNA Lentiviral Transduction Particles
thymopoietin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1293s21c1
Sequence:CCGGTGAGAGCTCACAACTAATTTCCTCGAGGAAATTAGTTGTGAGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-611s21c1
Sequence:CCGGGAACAACCAGGAAGCTATATGCTCGAGCATATAGCTTCCTGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003276.1-2315s21c1
Sequence:CCGGATCTTATCTTTCAGGTACTTTCTCGAGAAAGTACCTGAAAGATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1226s21c1
Sequence:CCGGGTCCTGAGAGGTCCCATATTTCTCGAGAAATATGGGACCTCTCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003276.1-1048s21c1
Sequence:CCGGTCTAGCCATGATAGGTGTTTACTCGAGTAAACACCTATCATGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003276.1-2326s1c1
Sequence:CCGGCAGGTACTTTATGCCAACATTCTCGAGAATGTTGGCATAAAGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003276.1-1783s1c1
Sequence:CCGGGCAACACAGATATTATCAGTTCTCGAGAACTGATAATATCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-1634s1c1
Sequence:CCGGCTAAGCAATCACAGCATGATACTCGAGTATCATGCTGTGATTGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-574s1c1
Sequence:CCGGCTTGTGAAATACGGAGTGAATCTCGAGATTCACTCCGTATTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003276.1-2005s1c1
Sequence:CCGGGCACAGATTCTTAGCTCAGATCTCGAGATCTGAGCTAAGAATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011605
TMPO MISSION shRNA Bacterial Glycerol Stock
thymopoietin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1143s21c1
Sequence:CCGGCCATCTTCTCAGCGTGAATTTCTCGAGAAATTCACGCTGAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-2332s21c1
Sequence:CCGGAGCGTGGAAATAAGCAGTAATCTCGAGATTACTGCTTATTTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1659s21c1
Sequence:CCGGTCTCATTCTCTGACTACTTTACTCGAGTAAAGTAGTCAGAGAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011605.2-2639s21c1
Sequence:CCGGTGATGCATAGGTCGGAGTTAACTCGAGTTAACTCCGACCTATGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1839s21c1
Sequence:CCGGATCGAGGCAGCACGGATATTACTCGAGTAATATCCGTGCTGCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1458s1c1
Sequence:CCGGCCAGCTATCAAGATTCTGAATCTCGAGATTCAGAATCTTGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1334s1c1
Sequence:CCGGGCTCAGGCAATTCGAGATTATCTCGAGATAATCTCGAATTGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1058s1c1
Sequence:CCGGCTATGCTATGATAGATGTGTACTCGAGTACACATCTATCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-814s1c1
Sequence:CCGGCGCTAGGGATTGTGTTCCTTTCTCGAGAAAGGAACACAATCCCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-637s1c1
Sequence:CCGGGCTATATGAGAAGAAGCTGTTCTCGAGAACAGCTTCTTCTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011605
TMPO MISSION shRNA shRNA Plasmid DNA
thymopoietin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1143s21c1
Sequence:CCGGCCATCTTCTCAGCGTGAATTTCTCGAGAAATTCACGCTGAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-2332s21c1
Sequence:CCGGAGCGTGGAAATAAGCAGTAATCTCGAGATTACTGCTTATTTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1659s21c1
Sequence:CCGGTCTCATTCTCTGACTACTTTACTCGAGTAAAGTAGTCAGAGAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011605.2-2639s21c1
Sequence:CCGGTGATGCATAGGTCGGAGTTAACTCGAGTTAACTCCGACCTATGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1839s21c1
Sequence:CCGGATCGAGGCAGCACGGATATTACTCGAGTAATATCCGTGCTGCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1458s1c1
Sequence:CCGGCCAGCTATCAAGATTCTGAATCTCGAGATTCAGAATCTTGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1334s1c1
Sequence:CCGGGCTCAGGCAATTCGAGATTATCTCGAGATAATCTCGAATTGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1058s1c1
Sequence:CCGGCTATGCTATGATAGATGTGTACTCGAGTACACATCTATCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-814s1c1
Sequence:CCGGCGCTAGGGATTGTGTTCCTTTCTCGAGAAAGGAACACAATCCCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-637s1c1
Sequence:CCGGGCTATATGAGAAGAAGCTGTTCTCGAGAACAGCTTCTTCTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011605
TMPO MISSION shRNA Lentiviral Transduction Particles
thymopoietin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1143s21c1
Sequence:CCGGCCATCTTCTCAGCGTGAATTTCTCGAGAAATTCACGCTGAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-2332s21c1
Sequence:CCGGAGCGTGGAAATAAGCAGTAATCTCGAGATTACTGCTTATTTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1659s21c1
Sequence:CCGGTCTCATTCTCTGACTACTTTACTCGAGTAAAGTAGTCAGAGAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011605.2-2639s21c1
Sequence:CCGGTGATGCATAGGTCGGAGTTAACTCGAGTTAACTCCGACCTATGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011605.2-1839s21c1
Sequence:CCGGATCGAGGCAGCACGGATATTACTCGAGTAATATCCGTGCTGCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1458s1c1
Sequence:CCGGCCAGCTATCAAGATTCTGAATCTCGAGATTCAGAATCTTGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1334s1c1
Sequence:CCGGGCTCAGGCAATTCGAGATTATCTCGAGATAATCTCGAATTGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-1058s1c1
Sequence:CCGGCTATGCTATGATAGATGTGTACTCGAGTACACATCTATCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-814s1c1
Sequence:CCGGCGCTAGGGATTGTGTTCCTTTCTCGAGAAAGGAACACAATCCCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011605.1-637s1c1
Sequence:CCGGGCTATATGAGAAGAAGCTGTTCTCGAGAACAGCTTCTTCTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks