EMAIL THIS PAGE TO A FRIEND

TMPPE

transmembrane protein with metallophosphoesterase domain

UniProtKB ID: Q6ZT21, B2RNG5, Q6ZRG1
Gene ID:
Mouse(100504715) transmembrane protein with metallophosphoesterase domain
Zebrafish(569483) transmembrane protein with metallophosphoesterase domain
chicken(101750979) transmembrane protein with metallophosphoesterase domain
chicken(101667793) transmembrane protein with metallophosphoesterase domain
domestic cat(101093637) transmembrane protein with metallophosphoesterase domain
dog(485578) transmembrane protein with metallophosphoesterase domain
domestic guinea pig(100721628) transmembrane protein with metallophosphoesterase domain
naked mole-rat(101712908) transmembrane protein with metallophosphoesterase domain
cow(527730) transmembrane protein with metallophosphoesterase domain
sheep(101105606) transmembrane protein with metallophosphoesterase domain
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039770 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013981 MISSION® esiRNA esiRNA targeting human TMPPE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039770 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168740 predicted 556
2 SASI_Hs01_00168741 predicted 350
3 SASI_Hs01_00168743 predicted 1345
4 SASI_Hs01_00168745 predicted 908
5 SASI_Hs01_00168746 predicted 1392
6 SASI_Hs01_00168747 predicted 999
7 SASI_Hs02_00308667 predicted 1049
8 SASI_Hs01_00168748 predicted 331
9 SASI_Hs01_00168749 predicted 1452
10 SASI_Hs02_00308668 predicted 1470
11 SASI_Hs01_00168742 predicted 1284
12 SASI_Hs01_00168744 predicted 1335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039770
TMPPE MISSION shRNA Bacterial Glycerol Stock
transmembrane protein with metallophosphoesterase domain
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-1444s21c1
Sequence:CCGGCCCAGGCTACATTCGTGTATGCTCGAGCATACACGAATGTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-361s21c1
Sequence:CCGGTCATTGGCTCCCTCTACATTTCTCGAGAAATGTAGAGGGAGCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-1324s21c1
Sequence:CCGGTCCAGGCTCGGCCAGATATTACTCGAGTAATATCTGGCCGAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-475s21c1
Sequence:CCGGTGGCCCATTCCAGTTTCTTTACTCGAGTAAAGAAACTGGAATGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039770.2-1778s21c1
Sequence:CCGGAGATCACTAAGGTCACATATACTCGAGTATATGTGACCTTAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039770
TMPPE MISSION shRNA shRNA Plasmid DNA
transmembrane protein with metallophosphoesterase domain
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-1444s21c1
Sequence:CCGGCCCAGGCTACATTCGTGTATGCTCGAGCATACACGAATGTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-361s21c1
Sequence:CCGGTCATTGGCTCCCTCTACATTTCTCGAGAAATGTAGAGGGAGCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-1324s21c1
Sequence:CCGGTCCAGGCTCGGCCAGATATTACTCGAGTAATATCTGGCCGAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-475s21c1
Sequence:CCGGTGGCCCATTCCAGTTTCTTTACTCGAGTAAAGAAACTGGAATGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039770.2-1778s21c1
Sequence:CCGGAGATCACTAAGGTCACATATACTCGAGTATATGTGACCTTAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039770
TMPPE MISSION shRNA Lentiviral Transduction Particles
transmembrane protein with metallophosphoesterase domain
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-1444s21c1
Sequence:CCGGCCCAGGCTACATTCGTGTATGCTCGAGCATACACGAATGTAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-361s21c1
Sequence:CCGGTCATTGGCTCCCTCTACATTTCTCGAGAAATGTAGAGGGAGCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-1324s21c1
Sequence:CCGGTCCAGGCTCGGCCAGATATTACTCGAGTAATATCTGGCCGAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039770.2-475s21c1
Sequence:CCGGTGGCCCATTCCAGTTTCTTTACTCGAGTAAAGAAACTGGAATGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039770.2-1778s21c1
Sequence:CCGGAGATCACTAAGGTCACATATACTCGAGTATATGTGACCTTAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks