EMAIL THIS PAGE TO A FRIEND

TMPRSS11A

transmembrane protease, serine 11A

Synonyms: ECRG1
UniProtKB ID: Q6ZMR5, Q2NKI9, Q6JE90, Q7RTY4, Q86TK8
Gene ID:
Mouse(194597) transmembrane protease, serine 11a
Rat(686581) transmembrane protease, serine 11A
cow(517049) transmembrane protease, serine 11A
sheep(101121013) transmembrane protease, serine 11A
naked mole-rat(101712261) transmembrane protease, serine 11A
domestic guinea pig(100721124) transmembrane protease, serine 11A
dog(482173) transmembrane protease, serine 11A
Horse(100067321) transmembrane protease, serine 11A
domestic cat(101100049) transmembrane protease, serine 11A
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_110701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU162001 MISSION® esiRNA esiRNA targeting mouse Tmprss11a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114387 Rosetta Predictions human pricing
NM_182606 Rosetta Predictions human pricing
XM_001074837 Rosetta Predictions rat pricing
NM_001033233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326564 predicted 649
2 SASI_Hs02_00326565 predicted 1135
3 SASI_Hs02_00326566 predicted 582
4 SASI_Hs02_00326567 predicted 1399
5 SASI_Hs02_00326568 predicted 1464
6 SASI_Hs02_00326569 predicted 1181
7 SASI_Hs02_00326570 predicted 1404
8 SASI_Hs02_00326571 predicted 1324
9 SASI_Hs02_00326572 predicted 1255
10 SASI_Hs02_00326573 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207813 predicted 656
2 SASI_Hs01_00207814 predicted 1149
3 SASI_Hs01_00207815 predicted 587
4 SASI_Hs01_00207816 predicted 1406
5 SASI_Hs01_00207819 predicted 1468
6 SASI_Hs02_00370740 predicted 1186
7 SASI_Hs02_00370741 predicted 1408
8 SASI_Hs02_00370742 predicted 1332
9 SASI_Hs02_00370743 predicted 1269
10 SASI_Hs02_00370744 predicted 885
11 SASI_Hs01_00207817 predicted 896
12 SASI_Hs01_00207818 predicted 1456
13 SASI_Hs01_00207820 predicted 470
14 SASI_Hs01_00207821 predicted 1174
15 SASI_Hs01_00207822 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347471 predicted 886
2 SASI_Rn02_00347472 predicted 768
3 SASI_Rn02_00347473 predicted 921
4 SASI_Rn02_00347474 predicted 667
5 SASI_Rn02_00347475 predicted 246
6 SASI_Rn02_00347476 predicted 222
7 SASI_Rn02_00347477 predicted 287
8 SASI_Rn02_00347478 predicted 813
9 SASI_Rn02_00347479 predicted 195
10 SASI_Rn02_00347480 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101926 predicted 488
2 SASI_Mm01_00101927 predicted 937
3 SASI_Mm01_00101928 predicted 1071
4 SASI_Mm01_00101929 predicted 305
5 SASI_Mm01_00101930 predicted 1179
6 SASI_Mm01_00101931 predicted 1383
7 SASI_Mm01_00101932 predicted 1343
8 SASI_Mm01_00101933 predicted 584
9 SASI_Mm01_00101934 predicted 912
10 SASI_Mm01_00101935 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182606
TMPRSS11A MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182606.3-1413s21c1
Sequence:CCGGAGCTGTATGCAGGTCATATATCTCGAGATATATGACCTGCATACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-192s1c1
Sequence:CCGGCCTGGTTCACTTCCTAGTATTCTCGAGAATACTAGGAAGTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-622s1c1
Sequence:CCGGCCACTAAACGTCAACAGAATACTCGAGTATTCTGTTGACGTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-1208s1c1
Sequence:CCGGGATCTGAAAGATACGTGGTATCTCGAGATACCACGTATCTTTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-541s1c1
Sequence:CCGGGCCTCATCAGTTCAAGTTAATCTCGAGATTAACTTGAACTGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-1100s1c1
Sequence:CCGGCACAGGTGTATGGCAATGATACTCGAGTATCATTGCCATACACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182606
TMPRSS11A MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182606.3-1413s21c1
Sequence:CCGGAGCTGTATGCAGGTCATATATCTCGAGATATATGACCTGCATACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-192s1c1
Sequence:CCGGCCTGGTTCACTTCCTAGTATTCTCGAGAATACTAGGAAGTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-622s1c1
Sequence:CCGGCCACTAAACGTCAACAGAATACTCGAGTATTCTGTTGACGTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-1208s1c1
Sequence:CCGGGATCTGAAAGATACGTGGTATCTCGAGATACCACGTATCTTTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-541s1c1
Sequence:CCGGGCCTCATCAGTTCAAGTTAATCTCGAGATTAACTTGAACTGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-1100s1c1
Sequence:CCGGCACAGGTGTATGGCAATGATACTCGAGTATCATTGCCATACACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182606
TMPRSS11A MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182606.3-1413s21c1
Sequence:CCGGAGCTGTATGCAGGTCATATATCTCGAGATATATGACCTGCATACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-192s1c1
Sequence:CCGGCCTGGTTCACTTCCTAGTATTCTCGAGAATACTAGGAAGTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-622s1c1
Sequence:CCGGCCACTAAACGTCAACAGAATACTCGAGTATTCTGTTGACGTTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-1208s1c1
Sequence:CCGGGATCTGAAAGATACGTGGTATCTCGAGATACCACGTATCTTTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-541s1c1
Sequence:CCGGGCCTCATCAGTTCAAGTTAATCTCGAGATTAACTTGAACTGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182606.1-1100s1c1
Sequence:CCGGCACAGGTGTATGGCAATGATACTCGAGTATCATTGCCATACACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110701
TMPRSS11A MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-948s1c1
Sequence:CCGGCCCACCAAATTCAACTGTCTACTCGAGTAGACAGTTGAATTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-971s1c1
Sequence:CCGGTCACAGGATTCGGAGCACTTTCTCGAGAAAGTGCTCCGAATCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-495s1c1
Sequence:CCGGCCATAGCATCTTAGATCAGAACTCGAGTTCTGATCTAAGATGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-847s1c1
Sequence:CCGGCCAGCAAGAGACCATGACATTCTCGAGAATGTCATGGTCTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-255s1c1
Sequence:CCGGCGTGTTCGATATTCAAGTCAACTCGAGTTGACTTGAATATCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110701
TMPRSS11A MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-948s1c1
Sequence:CCGGCCCACCAAATTCAACTGTCTACTCGAGTAGACAGTTGAATTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-971s1c1
Sequence:CCGGTCACAGGATTCGGAGCACTTTCTCGAGAAAGTGCTCCGAATCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-495s1c1
Sequence:CCGGCCATAGCATCTTAGATCAGAACTCGAGTTCTGATCTAAGATGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-847s1c1
Sequence:CCGGCCAGCAAGAGACCATGACATTCTCGAGAATGTCATGGTCTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-255s1c1
Sequence:CCGGCGTGTTCGATATTCAAGTCAACTCGAGTTGACTTGAATATCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110701
TMPRSS11A MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-948s1c1
Sequence:CCGGCCCACCAAATTCAACTGTCTACTCGAGTAGACAGTTGAATTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-971s1c1
Sequence:CCGGTCACAGGATTCGGAGCACTTTCTCGAGAAAGTGCTCCGAATCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-495s1c1
Sequence:CCGGCCATAGCATCTTAGATCAGAACTCGAGTTCTGATCTAAGATGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-847s1c1
Sequence:CCGGCCAGCAAGAGACCATGACATTCTCGAGAATGTCATGGTCTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110701.2-255s1c1
Sequence:CCGGCGTGTTCGATATTCAAGTCAACTCGAGTTGACTTGAATATCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks