EMAIL THIS PAGE TO A FRIEND

TMPRSS11B

transmembrane protease, serine 11B

UniProtKB ID: Q86T26, A8K4D9
Gene ID:
Rat(365265) transmembrane protease, serine 11b
domestic cat(101099042) transmembrane protease, serine 11B
Horse(100067463) transmembrane protease, serine 11B
naked mole-rat(101710809) transmembrane protease, serine 11B
cow(100140029) transmembrane protease, serine 11B
sheep(101116231) transmembrane protease, serine 11B
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182502 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135841 MISSION® esiRNA esiRNA human TMPRSS11B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182502 Rosetta Predictions human pricing
NM_001004020 Rosetta Predictions rat pricing
XM_579116 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236866 predicted 463
2 SASI_Hs01_00236867 predicted 633
3 SASI_Hs02_00370555 predicted 660
4 SASI_Hs02_00370556 predicted 1160
5 SASI_Hs01_00236868 predicted 979
6 SASI_Hs01_00236870 predicted 500
7 SASI_Hs01_00236872 predicted 440
8 SASI_Hs02_00370557 predicted 847
9 SASI_Hs01_00236874 predicted 360
10 SASI_Hs02_00370558 predicted 647
11 SASI_Hs01_00236869 predicted 850
12 SASI_Hs01_00236871 predicted 373
13 SASI_Hs01_00236873 predicted 1087
14 SASI_Hs01_00236875 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040578 predicted 202
2 SASI_Rn01_00040579 predicted 343
3 SASI_Rn02_00198086 predicted 694
4 SASI_Rn01_00040580 predicted 268
5 SASI_Rn01_00040581 predicted 402
6 SASI_Rn01_00040583 predicted 708
7 SASI_Rn01_00040584 predicted 749
8 SASI_Rn01_00040585 predicted 973
9 SASI_Rn01_00040586 predicted 276
10 SASI_Rn01_00040587 predicted 1012
11 SASI_Rn01_00040582 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182477 predicted 1014
2 SASI_Rn01_00182478 predicted 976
3 SASI_Rn01_00182479 predicted 939
4 SASI_Rn01_00182480 predicted 974
5 SASI_Rn01_00182481 predicted 1013
6 SASI_Rn01_00182482 predicted 945
7 SASI_Rn01_00182483 predicted 1038
8 SASI_Rn01_00182484 predicted 1034
9 SASI_Rn01_00182485 predicted 1005
10 SASI_Rn01_00182486 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182502
TMPRSS11B MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182502.1-1427s1c1
Sequence:CCGGGCTATCCTTATCTGTGGCTTTCTCGAGAAAGCCACAGATAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-1338s1c1
Sequence:CCGGCGAGTGACTTCTTATCGCAATCTCGAGATTGCGATAAGAAGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-170s1c1
Sequence:CCGGGCCACTATGGACTACGATCTTCTCGAGAAGATCGTAGTCCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-585s1c1
Sequence:CCGGGCTTCCATTAAACTCATGGAACTCGAGTTCCATGAGTTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-252s1c1
Sequence:CCGGGCAGTTGAGAAGACTTACTATCTCGAGATAGTAAGTCTTCTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-399s21c1
Sequence:CCGGCCAGTATATATAAGGAATATGCTCGAGCATATTCCTTATATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-780s21c1
Sequence:CCGGTCAGCAGCAGGTGGCTATTATCTCGAGATAATAGCCACCTGCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-300s21c1
Sequence:CCGGGAGTCACATACAATGATAATTCTCGAGAATTATCATTGTATGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-346s21c1
Sequence:CCGGCACAAATCTAAGCAAAGATATCTCGAGATATCTTTGCTTAGATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182502
TMPRSS11B MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182502.1-1427s1c1
Sequence:CCGGGCTATCCTTATCTGTGGCTTTCTCGAGAAAGCCACAGATAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-1338s1c1
Sequence:CCGGCGAGTGACTTCTTATCGCAATCTCGAGATTGCGATAAGAAGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-170s1c1
Sequence:CCGGGCCACTATGGACTACGATCTTCTCGAGAAGATCGTAGTCCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-585s1c1
Sequence:CCGGGCTTCCATTAAACTCATGGAACTCGAGTTCCATGAGTTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-252s1c1
Sequence:CCGGGCAGTTGAGAAGACTTACTATCTCGAGATAGTAAGTCTTCTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-399s21c1
Sequence:CCGGCCAGTATATATAAGGAATATGCTCGAGCATATTCCTTATATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-780s21c1
Sequence:CCGGTCAGCAGCAGGTGGCTATTATCTCGAGATAATAGCCACCTGCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-300s21c1
Sequence:CCGGGAGTCACATACAATGATAATTCTCGAGAATTATCATTGTATGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-346s21c1
Sequence:CCGGCACAAATCTAAGCAAAGATATCTCGAGATATCTTTGCTTAGATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182502
TMPRSS11B MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182502.1-1427s1c1
Sequence:CCGGGCTATCCTTATCTGTGGCTTTCTCGAGAAAGCCACAGATAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-1338s1c1
Sequence:CCGGCGAGTGACTTCTTATCGCAATCTCGAGATTGCGATAAGAAGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-170s1c1
Sequence:CCGGGCCACTATGGACTACGATCTTCTCGAGAAGATCGTAGTCCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-585s1c1
Sequence:CCGGGCTTCCATTAAACTCATGGAACTCGAGTTCCATGAGTTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182502.1-252s1c1
Sequence:CCGGGCAGTTGAGAAGACTTACTATCTCGAGATAGTAAGTCTTCTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-399s21c1
Sequence:CCGGCCAGTATATATAAGGAATATGCTCGAGCATATTCCTTATATATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-780s21c1
Sequence:CCGGTCAGCAGCAGGTGGCTATTATCTCGAGATAATAGCCACCTGCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-300s21c1
Sequence:CCGGGAGTCACATACAATGATAATTCTCGAGAATTATCATTGTATGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182502.3-346s21c1
Sequence:CCGGCACAAATCTAAGCAAAGATATCTCGAGATATCTTTGCTTAGATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks