EMAIL THIS PAGE TO A FRIEND

TMPRSS11BNL

TMPRSS11B N-terminal like

UniProtKB ID: B3KVV0
Gene ID:
Mouse(319875) transmembrane protease, serine 11b N terminal like
cow(785585) TMPRSS11B N terminal-like
sheep(101115964) TMPRSS11B N terminal-like
naked mole-rat(101711173) TMPRSS11B N-terminal like
domestic guinea pig(100721960) TMPRSS11B N-terminal like
domestic cat(101099294) TMPRSS11B N terminal-like
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084301 MISSION® esiRNA esiRNA targeting mouse Tmprss11b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346971 predicted 504
2 SASI_Mm01_00078009 predicted 286
3 SASI_Mm01_00078005 predicted 353
4 SASI_Mm02_00346972 predicted 650
5 SASI_Mm01_00078008 predicted 1007
6 SASI_Mm02_00346973 predicted 451
7 SASI_Mm01_00078011 predicted 734
8 SASI_Mm01_00078013 predicted 1031
9 SASI_Mm02_00346974 predicted 281
10 SASI_Mm02_00346975 predicted 757
11 SASI_Mm01_00078004 predicted 349
12 SASI_Mm01_00078006 predicted 212
13 SASI_Mm01_00078007 predicted 233
14 SASI_Mm01_00078010 predicted 237
15 SASI_Mm01_00078012 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129907
TMPRSS11BNL MISSION shRNA Bacterial Glycerol Stock
TMPRSS11B N-terminal like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-432s21c1
Sequence:CCGGCTAGCATTTACAGACAATATACTCGAGTATATTGTCTGTAAATGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129907.1-948s21c1
Sequence:CCGGACCTTCTAGTCACCATAATAACTCGAGTTATTATGGTGACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-474s21c1
Sequence:CCGGTGGTGTAAGTAACCAACATTACTCGAGTAATGTTGGTTACTTACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-327s21c1
Sequence:CCGGATGCTGGATATCCCATATAATCTCGAGATTATATGGGATATCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129907.1-903s21c1
Sequence:CCGGAGGTTAGGAGACAGCATATTTCTCGAGAAATATGCTGTCTCCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-305s21c1
Sequence:CCGGCTTCTACCAAGGTAGCTTTAACTCGAGTTAAAGCTACCTTGGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-404s21c1
Sequence:CCGGGACTAGATGGTTGATGCATTTCTCGAGAAATGCATCAACCATCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129907
TMPRSS11BNL MISSION shRNA shRNA Plasmid DNA
TMPRSS11B N-terminal like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-432s21c1
Sequence:CCGGCTAGCATTTACAGACAATATACTCGAGTATATTGTCTGTAAATGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129907.1-948s21c1
Sequence:CCGGACCTTCTAGTCACCATAATAACTCGAGTTATTATGGTGACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-474s21c1
Sequence:CCGGTGGTGTAAGTAACCAACATTACTCGAGTAATGTTGGTTACTTACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-327s21c1
Sequence:CCGGATGCTGGATATCCCATATAATCTCGAGATTATATGGGATATCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129907.1-903s21c1
Sequence:CCGGAGGTTAGGAGACAGCATATTTCTCGAGAAATATGCTGTCTCCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-305s21c1
Sequence:CCGGCTTCTACCAAGGTAGCTTTAACTCGAGTTAAAGCTACCTTGGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-404s21c1
Sequence:CCGGGACTAGATGGTTGATGCATTTCTCGAGAAATGCATCAACCATCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129907
TMPRSS11BNL MISSION shRNA Lentiviral Transduction Particles
TMPRSS11B N-terminal like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-432s21c1
Sequence:CCGGCTAGCATTTACAGACAATATACTCGAGTATATTGTCTGTAAATGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129907.1-948s21c1
Sequence:CCGGACCTTCTAGTCACCATAATAACTCGAGTTATTATGGTGACTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-474s21c1
Sequence:CCGGTGGTGTAAGTAACCAACATTACTCGAGTAATGTTGGTTACTTACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-327s21c1
Sequence:CCGGATGCTGGATATCCCATATAATCTCGAGATTATATGGGATATCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129907.1-903s21c1
Sequence:CCGGAGGTTAGGAGACAGCATATTTCTCGAGAAATATGCTGTCTCCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-305s21c1
Sequence:CCGGCTTCTACCAAGGTAGCTTTAACTCGAGTTAAAGCTACCTTGGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129907.1-404s21c1
Sequence:CCGGGACTAGATGGTTGATGCATTTCTCGAGAAATGCATCAACCATCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177024
TMPRSS11BNL MISSION shRNA Bacterial Glycerol Stock
TMPRSS11B N-terminal like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177024.2-1610s1c1
Sequence:CCGGCCGGCTATTTCTGTCTTCTAACTCGAGTTAGAAGACAGAAATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-889s1c1
Sequence:CCGGGCAGTTATAAAGCTCACTGAACTCGAGTTCAGTGAGCTTTATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-328s1c1
Sequence:CCGGGCCTTTCAGAATTCTAACATTCTCGAGAATGTTAGAATTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-814s1c1
Sequence:CCGGGCCTACATGCAGCATTCTGTTCTCGAGAACAGAATGCTGCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-1278s1c1
Sequence:CCGGGAGAGTAACTTCCTACCGTAACTCGAGTTACGGTAGGAAGTTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177024
TMPRSS11BNL MISSION shRNA shRNA Plasmid DNA
TMPRSS11B N-terminal like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177024.2-1610s1c1
Sequence:CCGGCCGGCTATTTCTGTCTTCTAACTCGAGTTAGAAGACAGAAATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-889s1c1
Sequence:CCGGGCAGTTATAAAGCTCACTGAACTCGAGTTCAGTGAGCTTTATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-328s1c1
Sequence:CCGGGCCTTTCAGAATTCTAACATTCTCGAGAATGTTAGAATTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-814s1c1
Sequence:CCGGGCCTACATGCAGCATTCTGTTCTCGAGAACAGAATGCTGCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-1278s1c1
Sequence:CCGGGAGAGTAACTTCCTACCGTAACTCGAGTTACGGTAGGAAGTTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177024
TMPRSS11BNL MISSION shRNA Lentiviral Transduction Particles
TMPRSS11B N-terminal like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177024.2-1610s1c1
Sequence:CCGGCCGGCTATTTCTGTCTTCTAACTCGAGTTAGAAGACAGAAATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-889s1c1
Sequence:CCGGGCAGTTATAAAGCTCACTGAACTCGAGTTCAGTGAGCTTTATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-328s1c1
Sequence:CCGGGCCTTTCAGAATTCTAACATTCTCGAGAATGTTAGAATTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-814s1c1
Sequence:CCGGGCCTACATGCAGCATTCTGTTCTCGAGAACAGAATGCTGCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177024.2-1278s1c1
Sequence:CCGGGAGAGTAACTTCCTACCGTAACTCGAGTTACGGTAGGAAGTTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks