EMAIL THIS PAGE TO A FRIEND

TMPRSS11D

transmembrane protease, serine 11D

Synonyms: HAT
UniProtKB ID: O60235, Q08AF6
Gene ID:
Human(9407) Summary: This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
Mouse(231382) transmembrane protease, serine 11d
Rat(64565) transmembrane protease, serine 11d
chicken(101748816) transmembrane protease, serine 11D
chicken(101664795) transmembrane protease, serine 11D
Horse(100067298) transmembrane protease, serine 11D
domestic cat(101100300) transmembrane protease, serine 11D
dog(611678) transmembrane protease, serine 11D
cow(521615) transmembrane protease, serine 11D
sheep(101120751) transmembrane protease, serine 11D
domestic guinea pig(100720850) transmembrane protease, serine 11D
naked mole-rat(101712609) transmembrane protease, serine 11D
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038361 MISSION® esiRNA esiRNA human TMPRSS11D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004262 Rosetta Predictions human pricing
NM_001033652 Rosetta Predictions rat pricing
NM_022630 Rosetta Predictions rat pricing
NM_145561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337224 predicted 819
2 SASI_Hs01_00063677 predicted 1412
3 SASI_Hs01_00063678 predicted 1082
4 SASI_Hs02_00337225 predicted 1370
5 SASI_Hs01_00063679 predicted 1070
6 SASI_Hs01_00063680 predicted 879
7 SASI_Hs01_00063681 predicted 239
8 SASI_Hs01_00063682 predicted 965
9 SASI_Hs01_00063683 predicted 436
10 SASI_Hs01_00063684 predicted 874
11 SASI_Hs01_00063676 predicted 1370
12 SASI_Hs01_00063685 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113098 predicted 1406
2 SASI_Rn01_00113099 predicted 1433
3 SASI_Rn01_00113101 predicted 1409
4 SASI_Rn02_00203650 predicted 1364
5 SASI_Rn01_00113102 predicted 1365
6 SASI_Rn02_00203651 predicted 924
7 SASI_Rn01_00113104 predicted 1363
8 SASI_Rn01_00113105 predicted 1440
9 SASI_Rn01_00113106 predicted 1415
10 SASI_Rn01_00113107 predicted 1438
11 SASI_Rn01_00113100 predicted 1424
12 SASI_Rn01_00113103 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086718 predicted 775
2 SASI_Rn01_00086719 predicted 807
3 SASI_Rn01_00086721 predicted 779
4 SASI_Rn02_00263418 predicted 734
5 SASI_Rn01_00086722 predicted 736
6 SASI_Rn02_00263419 predicted 295
7 SASI_Rn01_00086724 predicted 734
8 SASI_Rn01_00086725 predicted 803
9 SASI_Rn01_00086726 predicted 778
10 SASI_Rn01_00086727 predicted 809
11 SASI_Rn01_00086720 predicted 804
12 SASI_Rn01_00086723 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152384 predicted 270
2 SASI_Mm01_00152385 predicted 636
3 SASI_Mm01_00152386 predicted 835
4 SASI_Mm02_00341064 predicted 570
5 SASI_Mm01_00152387 predicted 1223
6 SASI_Mm01_00152388 predicted 385
7 SASI_Mm01_00152389 predicted 200
8 SASI_Mm01_00152390 predicted 598
9 SASI_Mm01_00152391 predicted 835
10 SASI_Mm01_00152393 predicted 1155
11 SASI_Mm01_00152392 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004262
TMPRSS11D MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-795s1c1
Sequence:CCGGCCACAACATTTCCTAAACTAACTCGAGTTAGTTTAGGAAATGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-432s1c1
Sequence:CCGGGAAATAACAATGGAGCATCAACTCGAGTTGATGCTCCATTGTTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-551s1c1
Sequence:CCGGGCTGCAGCAAATTGGCTTATTCTCGAGAATAAGCCAATTTGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-1278s1c1
Sequence:CCGGCAGCCTACCTTGACTGGATTACTCGAGTAATCCAGTCAAGGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-700s21c1
Sequence:CCGGGTGGAGGCAGCCTGATCAATACTCGAGTATTGATCAGGCTGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-1076s21c1
Sequence:CCGGTAATGCACCACATAGTTATAACTCGAGTTATAACTATGTGGTGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-777s21c1
Sequence:CCGGTGGATTGCCACGTCTGGTATTCTCGAGAATACCAGACGTGGCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004262
TMPRSS11D MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-795s1c1
Sequence:CCGGCCACAACATTTCCTAAACTAACTCGAGTTAGTTTAGGAAATGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-432s1c1
Sequence:CCGGGAAATAACAATGGAGCATCAACTCGAGTTGATGCTCCATTGTTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-551s1c1
Sequence:CCGGGCTGCAGCAAATTGGCTTATTCTCGAGAATAAGCCAATTTGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-1278s1c1
Sequence:CCGGCAGCCTACCTTGACTGGATTACTCGAGTAATCCAGTCAAGGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-700s21c1
Sequence:CCGGGTGGAGGCAGCCTGATCAATACTCGAGTATTGATCAGGCTGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-1076s21c1
Sequence:CCGGTAATGCACCACATAGTTATAACTCGAGTTATAACTATGTGGTGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-777s21c1
Sequence:CCGGTGGATTGCCACGTCTGGTATTCTCGAGAATACCAGACGTGGCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004262
TMPRSS11D MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-795s1c1
Sequence:CCGGCCACAACATTTCCTAAACTAACTCGAGTTAGTTTAGGAAATGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-432s1c1
Sequence:CCGGGAAATAACAATGGAGCATCAACTCGAGTTGATGCTCCATTGTTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-551s1c1
Sequence:CCGGGCTGCAGCAAATTGGCTTATTCTCGAGAATAAGCCAATTTGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004262.1-1278s1c1
Sequence:CCGGCAGCCTACCTTGACTGGATTACTCGAGTAATCCAGTCAAGGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-700s21c1
Sequence:CCGGGTGGAGGCAGCCTGATCAATACTCGAGTATTGATCAGGCTGCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-1076s21c1
Sequence:CCGGTAATGCACCACATAGTTATAACTCGAGTTATAACTATGTGGTGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004262.2-777s21c1
Sequence:CCGGTGGATTGCCACGTCTGGTATTCTCGAGAATACCAGACGTGGCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145561
TMPRSS11D MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-1144s1c1
Sequence:CCGGCGCTAGTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-886s1c1
Sequence:CCGGCCAGAAATATCCATAGGGTATCTCGAGATACCCTATGGATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-990s1c1
Sequence:CCGGGCAGTCACAAATCTACGGCAACTCGAGTTGCCGTAGATTTGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-87s1c1
Sequence:CCGGGCAGTAGCTTTCGTTGTCATACTCGAGTATGACAACGAAAGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-209s1c1
Sequence:CCGGCGTTGAATACACTGAGGCTTTCTCGAGAAAGCCTCAGTGTATTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145561
TMPRSS11D MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-1144s1c1
Sequence:CCGGCGCTAGTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-886s1c1
Sequence:CCGGCCAGAAATATCCATAGGGTATCTCGAGATACCCTATGGATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-990s1c1
Sequence:CCGGGCAGTCACAAATCTACGGCAACTCGAGTTGCCGTAGATTTGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-87s1c1
Sequence:CCGGGCAGTAGCTTTCGTTGTCATACTCGAGTATGACAACGAAAGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-209s1c1
Sequence:CCGGCGTTGAATACACTGAGGCTTTCTCGAGAAAGCCTCAGTGTATTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145561
TMPRSS11D MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-1144s1c1
Sequence:CCGGCGCTAGTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTACTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-886s1c1
Sequence:CCGGCCAGAAATATCCATAGGGTATCTCGAGATACCCTATGGATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-990s1c1
Sequence:CCGGGCAGTCACAAATCTACGGCAACTCGAGTTGCCGTAGATTTGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-87s1c1
Sequence:CCGGGCAGTAGCTTTCGTTGTCATACTCGAGTATGACAACGAAAGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145561.1-209s1c1
Sequence:CCGGCGTTGAATACACTGAGGCTTTCTCGAGAAAGCCTCAGTGTATTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks