EMAIL THIS PAGE TO A FRIEND

TMPRSS11E

transmembrane protease, serine 11E

Synonyms: DESC1 TMPRSS11E2
UniProtKB ID: Q9UL52, A6NL71, Q14DC8, Q6UW31
Gene ID:
Mouse(243084) transmembrane protease, serine 11e
Rat(305265) transmembrane protease, serine 11e
naked mole-rat(101702191) transmembrane protease, serine 11E
domestic guinea pig(100722230) transmembrane protease, serine 11E
cow(100335739) transmembrane protease, serine 11E
chicken(771454) transmembrane protease, serine 11E
domestic cat(101088329) transmembrane protease, serine 11E
dog(482176) transmembrane protease, serine 11E
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014058 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014058 Rosetta Predictions human pricing
XM_001074738 Rosetta Predictions rat pricing
XM_223301 Rosetta Predictions rat pricing
NM_172880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091707 predicted 409
2 SASI_Hs01_00091708 predicted 226
3 SASI_Hs01_00091709 predicted 1130
4 SASI_Hs01_00091710 predicted 245
5 SASI_Hs01_00091711 predicted 1087
6 SASI_Hs01_00091712 predicted 1110
7 SASI_Hs02_00345073 predicted 925
8 SASI_Hs01_00091715 predicted 405
9 SASI_Hs02_00345074 predicted 871
10 SASI_Hs02_00345075 predicted 941
11 SASI_Hs01_00091713 predicted 940
12 SASI_Hs01_00091714 predicted 231
13 SASI_Hs01_00091716 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347184 predicted 453
2 SASI_Rn02_00347185 predicted 1275
3 SASI_Rn02_00347186 predicted 386
4 SASI_Rn02_00347187 predicted 1376
5 SASI_Rn02_00347188 predicted 1678
6 SASI_Rn02_00347189 predicted 1534
7 SASI_Rn02_00347190 predicted 714
8 SASI_Rn02_00347191 predicted 905
9 SASI_Rn02_00347192 predicted 782
10 SASI_Rn02_00347193 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381250 predicted 456
2 SASI_Rn02_00381251 predicted 530
3 SASI_Rn02_00381252 predicted 1271
4 SASI_Rn02_00381253 predicted 386
5 SASI_Rn02_00381254 predicted 1381
6 SASI_Rn02_00381255 predicted 716
7 SASI_Rn02_00381256 predicted 909
8 SASI_Rn02_00381257 predicted 512
9 SASI_Rn02_00381258 predicted 775
10 SASI_Rn02_00381259 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052252 predicted 348
2 SASI_Mm01_00052253 predicted 539
3 SASI_Mm01_00052254 predicted 618
4 SASI_Mm01_00052255 predicted 987
5 SASI_Mm01_00052257 predicted 1020
6 SASI_Mm02_00344850 predicted 502
7 SASI_Mm01_00052258 predicted 1030
8 SASI_Mm01_00052259 predicted 1319
9 SASI_Mm01_00052260 predicted 342
10 SASI_Mm01_00052261 predicted 241
11 SASI_Mm01_00052256 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172880
TMPRSS11E MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11E
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172880.2-1117s21c1
Sequence:CCGGGTTGTGCGCTGGCTTCTTAAACTCGAGTTTAAGAAGCCAGCGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172880.2-1237s21c1
Sequence:CCCGTGAATGTGGCCAACCCAATAACTCGAGTTATTGGGTTGGCCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-865s1c1
Sequence:CCGGCCGTCCCATGACTATGACATTCTCGAGAATGTCATAGTCATGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-589s1c1
Sequence:CCGGCGACGGAACAAATCTACAGTACTCGAGTACTGTAGATTTGTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-832s1c1
Sequence:CCGGCGGAGGATAATTGTTCATGAACTCGAGTTCATGAACAATTATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-1073s1c1
Sequence:CCGGCCTGCAATCAGCCTCAATCTTCTCGAGAAGATTGAGGCTGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-101s1c1
Sequence:CCGGCCTGGGTTATCGGCATCATTTCTCGAGAAATGATGCCGATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172880.2-1523s21c1
Sequence:CCGGCAAGTGTTCTGTCGCCCAAATCTCGAGATTTGGGCGACAGAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172880
TMPRSS11E MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11E
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172880.2-1117s21c1
Sequence:CCGGGTTGTGCGCTGGCTTCTTAAACTCGAGTTTAAGAAGCCAGCGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172880.2-1237s21c1
Sequence:CCCGTGAATGTGGCCAACCCAATAACTCGAGTTATTGGGTTGGCCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-865s1c1
Sequence:CCGGCCGTCCCATGACTATGACATTCTCGAGAATGTCATAGTCATGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-589s1c1
Sequence:CCGGCGACGGAACAAATCTACAGTACTCGAGTACTGTAGATTTGTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-832s1c1
Sequence:CCGGCGGAGGATAATTGTTCATGAACTCGAGTTCATGAACAATTATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-1073s1c1
Sequence:CCGGCCTGCAATCAGCCTCAATCTTCTCGAGAAGATTGAGGCTGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-101s1c1
Sequence:CCGGCCTGGGTTATCGGCATCATTTCTCGAGAAATGATGCCGATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172880.2-1523s21c1
Sequence:CCGGCAAGTGTTCTGTCGCCCAAATCTCGAGATTTGGGCGACAGAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172880
TMPRSS11E MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11E
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172880.2-1117s21c1
Sequence:CCGGGTTGTGCGCTGGCTTCTTAAACTCGAGTTTAAGAAGCCAGCGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172880.2-1237s21c1
Sequence:CCCGTGAATGTGGCCAACCCAATAACTCGAGTTATTGGGTTGGCCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-865s1c1
Sequence:CCGGCCGTCCCATGACTATGACATTCTCGAGAATGTCATAGTCATGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-589s1c1
Sequence:CCGGCGACGGAACAAATCTACAGTACTCGAGTACTGTAGATTTGTTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-832s1c1
Sequence:CCGGCGGAGGATAATTGTTCATGAACTCGAGTTCATGAACAATTATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-1073s1c1
Sequence:CCGGCCTGCAATCAGCCTCAATCTTCTCGAGAAGATTGAGGCTGATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172880.1-101s1c1
Sequence:CCGGCCTGGGTTATCGGCATCATTTCTCGAGAAATGATGCCGATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172880.2-1523s21c1
Sequence:CCGGCAAGTGTTCTGTCGCCCAAATCTCGAGATTTGGGCGACAGAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014058
TMPRSS11E MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-1241s1c1
Sequence:CCGGCCTGGTGTTTATACTAGAGTTCTCGAGAACTCTAGTATAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-893s1c1
Sequence:CCGGCCCTACACAAATGCAGTACATCTCGAGATGTACTGCATTTGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-812s1c1
Sequence:CCGGCGGAGAATAATTGTCCATGAACTCGAGTTCATGGACAATTATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-1270s1c1
Sequence:CCGGGCGGGACTGGATTACTTCAAACTCGAGTTTGAAGTAATCCAGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-367s1c1
Sequence:CCGGGCATGGAGTGTTGGCTCATATCTCGAGATATGAGCCAACACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014058
TMPRSS11E MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-1241s1c1
Sequence:CCGGCCTGGTGTTTATACTAGAGTTCTCGAGAACTCTAGTATAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-893s1c1
Sequence:CCGGCCCTACACAAATGCAGTACATCTCGAGATGTACTGCATTTGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-812s1c1
Sequence:CCGGCGGAGAATAATTGTCCATGAACTCGAGTTCATGGACAATTATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-1270s1c1
Sequence:CCGGGCGGGACTGGATTACTTCAAACTCGAGTTTGAAGTAATCCAGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-367s1c1
Sequence:CCGGGCATGGAGTGTTGGCTCATATCTCGAGATATGAGCCAACACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014058
TMPRSS11E MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-1241s1c1
Sequence:CCGGCCTGGTGTTTATACTAGAGTTCTCGAGAACTCTAGTATAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-893s1c1
Sequence:CCGGCCCTACACAAATGCAGTACATCTCGAGATGTACTGCATTTGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-812s1c1
Sequence:CCGGCGGAGAATAATTGTCCATGAACTCGAGTTCATGGACAATTATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-1270s1c1
Sequence:CCGGGCGGGACTGGATTACTTCAAACTCGAGTTTGAAGTAATCCAGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014058.2-367s1c1
Sequence:CCGGGCATGGAGTGTTGGCTCATATCTCGAGATATGAGCCAACACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks