EMAIL THIS PAGE TO A FRIEND

TMPRSS11F

transmembrane protease, serine 11F

UniProtKB ID: Q6ZWK6, A8MXX2
Gene ID:
Mouse(243083) transmembrane protease, serine 11f
Rat(498345) transmembrane protease, serine 11f
chicken(428763) transmembrane protease, serine 11F
domestic cat(101099548) transmembrane protease, serine 11F
dog(482174) transmembrane protease, serine 11F
cow(785556) transmembrane protease, serine 11F
sheep(101121519) transmembrane protease, serine 11F
domestic guinea pig(100721677) transmembrane protease, serine 11F
naked mole-rat(101711537) transmembrane protease, serine 11F
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371695 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207407 Rosetta Predictions human pricing
XM_001074782 Rosetta Predictions rat pricing
XM_573578 Rosetta Predictions rat pricing
NM_178730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111874 predicted 1399
2 SASI_Hs01_00111875 predicted 937
3 SASI_Hs01_00111877 predicted 1365
4 SASI_Hs02_00374026 predicted 204
5 SASI_Hs02_00374027 predicted 335
6 SASI_Hs02_00374028 predicted 400
7 SASI_Hs01_00111878 predicted 1318
8 SASI_Hs01_00111879 predicted 1101
9 SASI_Hs01_00111880 predicted 1248
10 SASI_Hs01_00111881 predicted 312
11 SASI_Hs01_00111876 predicted 1038
12 SASI_Hs01_00111882 predicted 1141
13 SASI_Hs01_00111883 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347356 predicted 1771
2 SASI_Rn02_00347357 predicted 1169
3 SASI_Rn02_00347358 predicted 1343
4 SASI_Rn02_00347359 predicted 1745
5 SASI_Rn02_00347360 predicted 207
6 SASI_Rn02_00347361 predicted 1133
7 SASI_Rn02_00347362 predicted 429
8 SASI_Rn02_00347363 predicted 1385
9 SASI_Rn02_00347364 predicted 1775
10 SASI_Rn02_00347365 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400513 predicted 193
2 SASI_Rn02_00400514 predicted 1534
3 SASI_Rn02_00400515 predicted 440
4 SASI_Rn02_00400516 predicted 1478
5 SASI_Rn02_00400517 predicted 403
6 SASI_Rn02_00400518 predicted 651
7 SASI_Rn02_00400519 predicted 1041
8 SASI_Rn02_00400520 predicted 772
9 SASI_Rn02_00400521 predicted 1062
10 SASI_Rn02_00400522 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107343 predicted 767
2 SASI_Mm01_00107344 predicted 1543
3 SASI_Mm01_00107346 predicted 937
4 SASI_Mm01_00107348 predicted 723
5 SASI_Mm01_00107349 predicted 537
6 SASI_Mm01_00107350 predicted 949
7 SASI_Mm01_00107352 predicted 1372
8 SASI_Mm02_00349260 predicted 1503
9 SASI_Mm02_00349261 predicted 409
10 SASI_Mm02_00349262 predicted 1059
11 SASI_Mm01_00107345 predicted 841
12 SASI_Mm01_00107347 predicted 293
13 SASI_Mm01_00107351 predicted 1370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371695
TMPRSS11F MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11F
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371695.2-1610s1c1
Sequence:CCGGGCTTGTGATACTTCCTAATAACTCGAGTTATTAGGAAGTATCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-988s1c1
Sequence:CCGGCCTCCCAGACTCATCTATAAACTCGAGTTTATAGATGAGTCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-333s1c1
Sequence:CCGGTGTCTAGGATATTTCGACATTCTCGAGAATGTCGAAATATCCTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-1223s1c1
Sequence:CCGGCCTCTGGTTTATGATAATCATCTCGAGATGATTATCATAAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-1342s1c1
Sequence:CCGGGATTGCCTCAAAGACTGGTATCTCGAGATACCAGTCTTTGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371695
TMPRSS11F MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11F
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371695.2-1610s1c1
Sequence:CCGGGCTTGTGATACTTCCTAATAACTCGAGTTATTAGGAAGTATCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-988s1c1
Sequence:CCGGCCTCCCAGACTCATCTATAAACTCGAGTTTATAGATGAGTCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-333s1c1
Sequence:CCGGTGTCTAGGATATTTCGACATTCTCGAGAATGTCGAAATATCCTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-1223s1c1
Sequence:CCGGCCTCTGGTTTATGATAATCATCTCGAGATGATTATCATAAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-1342s1c1
Sequence:CCGGGATTGCCTCAAAGACTGGTATCTCGAGATACCAGTCTTTGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371695
TMPRSS11F MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11F
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371695.2-1610s1c1
Sequence:CCGGGCTTGTGATACTTCCTAATAACTCGAGTTATTAGGAAGTATCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-988s1c1
Sequence:CCGGCCTCCCAGACTCATCTATAAACTCGAGTTTATAGATGAGTCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-333s1c1
Sequence:CCGGTGTCTAGGATATTTCGACATTCTCGAGAATGTCGAAATATCCTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-1223s1c1
Sequence:CCGGCCTCTGGTTTATGATAATCATCTCGAGATGATTATCATAAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371695.2-1342s1c1
Sequence:CCGGGATTGCCTCAAAGACTGGTATCTCGAGATACCAGTCTTTGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178730
TMPRSS11F MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-957s1c1
Sequence:CCGGCCTCCCAGATTCATCTATGAACTCGAGTTCATAGATGAATCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-305s1c1
Sequence:CCGGCCAGGATATTCCGACGTTCTTCTCGAGAAGAACGTCGGAATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-826s1c1
Sequence:CCGGCCTTTAGTCAAACGAAGTGTTCTCGAGAACACTTCGTTTGACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-132s1c1
Sequence:CCGGCGCAATCGTAGGAATCACAATCTCGAGATTGTGATTCCTACGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-754s1c1
Sequence:CCGGGCAGCTCATTGCTTCTGGAAACTCGAGTTTCCAGAAGCAATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178730
TMPRSS11F MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-957s1c1
Sequence:CCGGCCTCCCAGATTCATCTATGAACTCGAGTTCATAGATGAATCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-305s1c1
Sequence:CCGGCCAGGATATTCCGACGTTCTTCTCGAGAAGAACGTCGGAATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-826s1c1
Sequence:CCGGCCTTTAGTCAAACGAAGTGTTCTCGAGAACACTTCGTTTGACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-132s1c1
Sequence:CCGGCGCAATCGTAGGAATCACAATCTCGAGATTGTGATTCCTACGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-754s1c1
Sequence:CCGGGCAGCTCATTGCTTCTGGAAACTCGAGTTTCCAGAAGCAATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178730
TMPRSS11F MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-957s1c1
Sequence:CCGGCCTCCCAGATTCATCTATGAACTCGAGTTCATAGATGAATCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-305s1c1
Sequence:CCGGCCAGGATATTCCGACGTTCTTCTCGAGAAGAACGTCGGAATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-826s1c1
Sequence:CCGGCCTTTAGTCAAACGAAGTGTTCTCGAGAACACTTCGTTTGACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-132s1c1
Sequence:CCGGCGCAATCGTAGGAATCACAATCTCGAGATTGTGATTCCTACGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178730.2-754s1c1
Sequence:CCGGGCAGCTCATTGCTTCTGGAAACTCGAGTTTCCAGAAGCAATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207407
TMPRSS11F MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 11F
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000433934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-855s21c1
Sequence:CCGGCACCCGCAGTGAAACGAAATGCTCGAGCATTTCGTTTCACTGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-521s21c1
Sequence:CCGGCAATTGTCTTTGACCATAAACCTCGAGGTTTATGGTCAAAGACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-153s21c1
Sequence:CCGGTAGCAATTGTAGCAATCATAGCTCGAGCTATGATTGCTACAATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207407.2-1403s21c1
Sequence:CCGGAGCTGATACTCCTGCGTATTTCTCGAGAAATACGCAGGAGTATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207407
TMPRSS11F MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 11F
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000433934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-855s21c1
Sequence:CCGGCACCCGCAGTGAAACGAAATGCTCGAGCATTTCGTTTCACTGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-521s21c1
Sequence:CCGGCAATTGTCTTTGACCATAAACCTCGAGGTTTATGGTCAAAGACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-153s21c1
Sequence:CCGGTAGCAATTGTAGCAATCATAGCTCGAGCTATGATTGCTACAATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207407.2-1403s21c1
Sequence:CCGGAGCTGATACTCCTGCGTATTTCTCGAGAAATACGCAGGAGTATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207407
TMPRSS11F MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 11F
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000433934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-855s21c1
Sequence:CCGGCACCCGCAGTGAAACGAAATGCTCGAGCATTTCGTTTCACTGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-521s21c1
Sequence:CCGGCAATTGTCTTTGACCATAAACCTCGAGGTTTATGGTCAAAGACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207407.2-153s21c1
Sequence:CCGGTAGCAATTGTAGCAATCATAGCTCGAGCTATGATTGCTACAATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207407.2-1403s21c1
Sequence:CCGGAGCTGATACTCCTGCGTATTTCTCGAGAAATACGCAGGAGTATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks