EMAIL THIS PAGE TO A FRIEND

TMPRSS12

transmembrane (C-terminal) protease, serine 12

UniProtKB ID: Q86WS5, B9ZVX2
Gene ID:
Mouse(75002) transmembrane (C-terminal) protease, serine 12
Rat(100362912) transmembrane (C-terminal) protease, serine 12
Zebrafish(100536434) transmembrane (C-terminal) protease, serine 12
chicken(426872) transmembrane (C-terminal) protease, serine 12
dog(608553) transmembrane (C-terminal) protease, serine 12
domestic cat(101094685) transmembrane (C-terminal) protease, serine 12
cow(100137906) transmembrane (C-terminal) protease, serine 12
sheep(101116644) transmembrane (C-terminal) protease, serine 12
domestic guinea pig(100735680) transmembrane (C-terminal) protease, serine 12
naked mole-rat(101705858) transmembrane (C-terminal) protease, serine 12
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182559 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182559 Rosetta Predictions human pricing
NM_183109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049774 predicted 541
2 SASI_Hs01_00049775 predicted 508
3 SASI_Hs01_00049776 predicted 986
4 SASI_Hs02_00370686 predicted 476
5 SASI_Hs01_00049778 predicted 867
6 SASI_Hs01_00049779 predicted 445
7 SASI_Hs01_00049780 predicted 1007
8 SASI_Hs01_00049781 predicted 1168
9 SASI_Hs01_00049782 predicted 536
10 SASI_Hs02_00370687 predicted 1069
11 SASI_Hs01_00049777 predicted 1078
12 SASI_Hs01_00049783 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350098 predicted 655
2 SASI_Mm02_00350099 predicted 737
3 SASI_Mm02_00350100 predicted 206
4 SASI_Mm02_00350101 predicted 217
5 SASI_Mm02_00350102 predicted 223
6 SASI_Mm02_00350103 predicted 685
7 SASI_Mm02_00350104 predicted 756
8 SASI_Mm01_00151704 predicted 393
9 SASI_Mm02_00350105 predicted 285
10 SASI_Mm02_00350106 predicted 499
11 SASI_Mm01_00151701 predicted 565
12 SASI_Mm01_00151702 predicted 567
13 SASI_Mm01_00151703 predicted 500
14 SASI_Mm01_00151705 predicted 404
15 SASI_Mm01_00151706 predicted 475
16 SASI_Mm01_00151707 predicted 459
17 SASI_Mm01_00151708 predicted 485
18 SASI_Mm01_00151709 predicted 528
19 SASI_Mm01_00151710 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183109
TMPRSS12 MISSION shRNA Bacterial Glycerol Stock
transmembrane (C-terminal) protease, serine 12
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-663s1c1
Sequence:CCGGCCAGAGAAGAAGGTAACTATTCTCGAGAATAGTTACCTTCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-560s1c1
Sequence:CCGGGCTGTGAGGTATAATGACTATCTCGAGATAGTCATTATACCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-526s1c1
Sequence:CCGGCGTAAATGATATCGCACTGTTCTCGAGAACAGTGCGATATCATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-756s1c1
Sequence:CCGGGTGTGCATCGAGCTACTAATTCTCGAGAATTAGTAGCTCGATGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183109
TMPRSS12 MISSION shRNA shRNA Plasmid DNA
transmembrane (C-terminal) protease, serine 12
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-663s1c1
Sequence:CCGGCCAGAGAAGAAGGTAACTATTCTCGAGAATAGTTACCTTCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-560s1c1
Sequence:CCGGGCTGTGAGGTATAATGACTATCTCGAGATAGTCATTATACCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-526s1c1
Sequence:CCGGCGTAAATGATATCGCACTGTTCTCGAGAACAGTGCGATATCATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-756s1c1
Sequence:CCGGGTGTGCATCGAGCTACTAATTCTCGAGAATTAGTAGCTCGATGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183109
TMPRSS12 MISSION shRNA Lentiviral Transduction Particles
transmembrane (C-terminal) protease, serine 12
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-663s1c1
Sequence:CCGGCCAGAGAAGAAGGTAACTATTCTCGAGAATAGTTACCTTCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-560s1c1
Sequence:CCGGGCTGTGAGGTATAATGACTATCTCGAGATAGTCATTATACCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-526s1c1
Sequence:CCGGCGTAAATGATATCGCACTGTTCTCGAGAACAGTGCGATATCATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183109.1-756s1c1
Sequence:CCGGGTGTGCATCGAGCTACTAATTCTCGAGAATTAGTAGCTCGATGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182559
TMPRSS12 MISSION shRNA Bacterial Glycerol Stock
transmembrane (C-terminal) protease, serine 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-331s1c1
Sequence:CCGGGCCGTGTTCTTGTTCATGTATCTCGAGATACATGAACAAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-997s1c1
Sequence:CCGGCTCAAGGCATACTTACTATAACTCGAGTTATAGTAAGTATGCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-570s1c1
Sequence:CCGGGCAGTGAGGTATAATGACTATCTCGAGATAGTCATTATACCTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-80s1c1
Sequence:CCGGTCACTTATACTCAGACCACTACTCGAGTAGTGGTCTGAGTATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-719s1c1
Sequence:CCGGGCATTATATTTCTCGAGAGATCTCGAGATCTCTCGAGAAATATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182559.2-856s21c1
Sequence:CCGGGACCATTAATGTGCTACTTACCTCGAGGTAAGTAGCACATTAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182559.2-693s21c1
Sequence:CCGGGAAGAAGGTAACGCTACAAATCTCGAGATTTGTAGCGTTACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182559
TMPRSS12 MISSION shRNA shRNA Plasmid DNA
transmembrane (C-terminal) protease, serine 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-331s1c1
Sequence:CCGGGCCGTGTTCTTGTTCATGTATCTCGAGATACATGAACAAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-997s1c1
Sequence:CCGGCTCAAGGCATACTTACTATAACTCGAGTTATAGTAAGTATGCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-570s1c1
Sequence:CCGGGCAGTGAGGTATAATGACTATCTCGAGATAGTCATTATACCTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-80s1c1
Sequence:CCGGTCACTTATACTCAGACCACTACTCGAGTAGTGGTCTGAGTATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-719s1c1
Sequence:CCGGGCATTATATTTCTCGAGAGATCTCGAGATCTCTCGAGAAATATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182559.2-856s21c1
Sequence:CCGGGACCATTAATGTGCTACTTACCTCGAGGTAAGTAGCACATTAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182559.2-693s21c1
Sequence:CCGGGAAGAAGGTAACGCTACAAATCTCGAGATTTGTAGCGTTACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182559
TMPRSS12 MISSION shRNA Lentiviral Transduction Particles
transmembrane (C-terminal) protease, serine 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-331s1c1
Sequence:CCGGGCCGTGTTCTTGTTCATGTATCTCGAGATACATGAACAAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-997s1c1
Sequence:CCGGCTCAAGGCATACTTACTATAACTCGAGTTATAGTAAGTATGCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-570s1c1
Sequence:CCGGGCAGTGAGGTATAATGACTATCTCGAGATAGTCATTATACCTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-80s1c1
Sequence:CCGGTCACTTATACTCAGACCACTACTCGAGTAGTGGTCTGAGTATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182559.1-719s1c1
Sequence:CCGGGCATTATATTTCTCGAGAGATCTCGAGATCTCTCGAGAAATATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182559.2-856s21c1
Sequence:CCGGGACCATTAATGTGCTACTTACCTCGAGGTAAGTAGCACATTAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182559.2-693s21c1
Sequence:CCGGGAAGAAGGTAACGCTACAAATCTCGAGATTTGTAGCGTTACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks