EMAIL THIS PAGE TO A FRIEND

TMPRSS13

transmembrane protease, serine 13

Synonyms: MSP MSPL MSPS TMPRSS11
UniProtKB ID: Q9BYE2, B4DTM9, Q86YM4, Q96JY8, Q9BYE1
Gene ID:
Human(84000) Summary: This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(214531) transmembrane protease, serine 13
Rat(300682) transmembrane protease, serine 13
naked mole-rat(101705956) transmembrane protease, serine 13
domestic guinea pig(100730002) transmembrane protease, serine 13
cow(529120) transmembrane protease, serine 13
sheep(101113360) transmembrane protease, serine 13
chicken(419770) transmembrane protease, serine 13
dog(610827) transmembrane protease, serine 13
domestic cat(101082593) transmembrane protease, serine 13
Horse(100071161) transmembrane protease, serine 13
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_150167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_150167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_150167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032046 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077263 Rosetta Predictions human pricing
NM_032046 Rosetta Predictions human pricing
NM_001127528 Rosetta Predictions rat pricing
NM_001013373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312334 predicted 434
2 SASI_Hs02_00312335 predicted 1540
3 SASI_Hs02_00312336 predicted 1307
4 SASI_Hs02_00312337 predicted 1273
5 SASI_Hs02_00312338 predicted 704
6 SASI_Hs02_00312339 predicted 940
7 SASI_Hs02_00312340 predicted 1535
8 SASI_Hs02_00312341 predicted 257
9 SASI_Hs02_00312342 predicted 774
10 SASI_Hs02_00312343 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091465 predicted 454
2 SASI_Hs01_00091466 predicted 824
3 SASI_Hs01_00091467 predicted 1453
4 SASI_Hs01_00091468 predicted 1216
5 SASI_Hs01_00091469 predicted 1187
6 SASI_Hs01_00091470 predicted 905
7 SASI_Hs01_00091471 predicted 614
8 SASI_Hs01_00091472 predicted 842
9 SASI_Hs01_00091473 predicted 1561
10 SASI_Hs01_00091474 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254033 predicted 625
2 SASI_Rn02_00254034 predicted 1275
3 SASI_Rn02_00254035 predicted 1389
4 SASI_Rn02_00254036 predicted 469
5 SASI_Rn02_00254037 predicted 736
6 SASI_Rn02_00254038 predicted 332
7 SASI_Rn02_00254039 predicted 289
8 SASI_Rn02_00254040 predicted 421
9 SASI_Rn02_00254041 predicted 226
10 SASI_Rn02_00254042 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147312 predicted 898
2 SASI_Mm01_00147314 predicted 1308
3 SASI_Mm01_00147315 predicted 317
4 SASI_Mm01_00147316 predicted 588
5 SASI_Mm01_00147317 predicted 376
6 SASI_Mm01_00147318 predicted 1427
7 SASI_Mm02_00287197 predicted 876
8 SASI_Mm01_00147320 predicted 2118
9 SASI_Mm01_00147313 predicted 1290
10 SASI_Mm01_00147321 predicted 273
11 SASI_Mm01_00147319 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_150167
TMPRSS13 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-704s1c1
Sequence:CCGGGCAGCTTCTTACTCTCCGAATCTCGAGATTCGGAGAGTAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-798s1c1
Sequence:CCGGCCACTGTGGTTTGAGAGCTATCTCGAGATAGCTCTCAAACCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-1182s1c1
Sequence:CCGGCCTCAATGAGACCTGTTGGATCTCGAGATCCAACAGGTCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-199s1c1
Sequence:CCGGCCAACGAGAGTGTACCTTGTTCTCGAGAACAAGGTACACTCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-1291s1c1
Sequence:CCGGTGCAATGACTACTTGGTCTATCTCGAGATAGACCAAGTAGTCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_150167
TMPRSS13 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-704s1c1
Sequence:CCGGGCAGCTTCTTACTCTCCGAATCTCGAGATTCGGAGAGTAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-798s1c1
Sequence:CCGGCCACTGTGGTTTGAGAGCTATCTCGAGATAGCTCTCAAACCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-1182s1c1
Sequence:CCGGCCTCAATGAGACCTGTTGGATCTCGAGATCCAACAGGTCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-199s1c1
Sequence:CCGGCCAACGAGAGTGTACCTTGTTCTCGAGAACAAGGTACACTCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-1291s1c1
Sequence:CCGGTGCAATGACTACTTGGTCTATCTCGAGATAGACCAAGTAGTCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_150167
TMPRSS13 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-704s1c1
Sequence:CCGGGCAGCTTCTTACTCTCCGAATCTCGAGATTCGGAGAGTAAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-798s1c1
Sequence:CCGGCCACTGTGGTTTGAGAGCTATCTCGAGATAGCTCTCAAACCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-1182s1c1
Sequence:CCGGCCTCAATGAGACCTGTTGGATCTCGAGATCCAACAGGTCTCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-199s1c1
Sequence:CCGGCCAACGAGAGTGTACCTTGTTCTCGAGAACAAGGTACACTCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_150167.3-1291s1c1
Sequence:CCGGTGCAATGACTACTTGGTCTATCTCGAGATAGACCAAGTAGTCATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032046
TMPRSS13 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032046.1-2770s1c1
Sequence:CCGGCCTGGGACTTTGGGATTTCTTCTCGAGAAGAAATCCCAAAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-1407s1c1
Sequence:CCGGGCAGGTCAATCTCATCGACTTCTCGAGAAGTCGATGAGATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-852s1c1
Sequence:CCGGCTTCTCAATCTTGAGATACAACTCGAGTTGTATCTCAAGATTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-687s1c1
Sequence:CCGGCTGGGACAAGTCTCTGCTTAACTCGAGTTAAGCAGAGACTTGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-448s1c1
Sequence:CCGGCCAACCAGAGTGTACCTTGTTCTCGAGAACAAGGTACACTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032046
TMPRSS13 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032046.1-2770s1c1
Sequence:CCGGCCTGGGACTTTGGGATTTCTTCTCGAGAAGAAATCCCAAAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-1407s1c1
Sequence:CCGGGCAGGTCAATCTCATCGACTTCTCGAGAAGTCGATGAGATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-852s1c1
Sequence:CCGGCTTCTCAATCTTGAGATACAACTCGAGTTGTATCTCAAGATTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-687s1c1
Sequence:CCGGCTGGGACAAGTCTCTGCTTAACTCGAGTTAAGCAGAGACTTGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-448s1c1
Sequence:CCGGCCAACCAGAGTGTACCTTGTTCTCGAGAACAAGGTACACTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032046
TMPRSS13 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032046.1-2770s1c1
Sequence:CCGGCCTGGGACTTTGGGATTTCTTCTCGAGAAGAAATCCCAAAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-1407s1c1
Sequence:CCGGGCAGGTCAATCTCATCGACTTCTCGAGAAGTCGATGAGATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-852s1c1
Sequence:CCGGCTTCTCAATCTTGAGATACAACTCGAGTTGTATCTCAAGATTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-687s1c1
Sequence:CCGGCTGGGACAAGTCTCTGCTTAACTCGAGTTAAGCAGAGACTTGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032046.1-448s1c1
Sequence:CCGGCCAACCAGAGTGTACCTTGTTCTCGAGAACAAGGTACACTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks