EMAIL THIS PAGE TO A FRIEND

TMPRSS15

transmembrane protease, serine 15

Synonyms: ENTK PRSS7
UniProtKB ID: P98073, Q2NKL7
Gene ID:
Human(5651) Summary: This gene encodes an enzyme that converts the pancreatic proenzyme trypsinogen to trypsin, which activates other proenzymes including chymotrypsinogen and procarboxypeptidases. The precursor protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. This protein is a member of the trypsin family of peptidases. Mutations in this gene cause enterokinase deficiency, a malabsorption disorder characterized by diarrhea and failure to thrive. [provided by RefSeq, Jul 2008]
Mouse(19146) transmembrane protease, serine 15
Rat(288291) transmembrane protease, serine 15
Zebrafish(100148042) transmembrane protease, serine 15
dog(487700) transmembrane protease, serine 15
domestic cat(101088868) transmembrane protease, serine 15
chicken(427967) transmembrane protease, serine 15
cow(282009) transmembrane protease, serine 15
sheep(101115497) transmembrane protease, serine 15
domestic guinea pig(100728703) transmembrane protease, serine 15
naked mole-rat(101719326) transmembrane protease, serine 15
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053651 MISSION® esiRNA esiRNA human PRSS7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002772 Rosetta Predictions human pricing
NM_001105895 Rosetta Predictions rat pricing
NM_008941 Rosetta Predictions mouse pricing
NM_178855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022094 predicted 824
2 SASI_Hs01_00022096 predicted 1339
3 SASI_Hs02_00334400 predicted 2278
4 SASI_Hs01_00022097 predicted 1669
5 SASI_Hs01_00022098 predicted 1315
6 SASI_Hs01_00022099 predicted 2627
7 SASI_Hs01_00022100 predicted 2591
8 SASI_Hs01_00022101 predicted 1792
9 SASI_Hs01_00022102 predicted 2555
10 SASI_Hs01_00022103 predicted 2111
11 SASI_Hs01_00022095 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213592 predicted 2873
2 SASI_Rn02_00213593 predicted 2413
3 SASI_Rn02_00213594 predicted 1577
4 SASI_Rn02_00213595 predicted 2255
5 SASI_Rn02_00213596 predicted 2805
6 SASI_Rn02_00213597 predicted 3060
7 SASI_Rn02_00213598 predicted 1674
8 SASI_Rn02_00213599 predicted 3242
9 SASI_Rn02_00213600 predicted 1331
10 SASI_Rn02_00213601 predicted 2825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022170 predicted 3396
2 SASI_Mm01_00022172 predicted 2946
3 SASI_Mm01_00022173 predicted 2993
4 SASI_Mm01_00022174 predicted 2577
5 SASI_Mm01_00022175 predicted 1794
6 SASI_Mm02_00314981 predicted 1103
7 SASI_Mm01_00022176 predicted 1065
8 SASI_Mm01_00022177 predicted 2326
9 SASI_Mm01_00022178 predicted 1950
10 SASI_Mm01_00022179 predicted 3363
11 SASI_Mm01_00022171 predicted 2975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037822 predicted 3355
2 SASI_Mm01_00037824 predicted 2911
3 SASI_Mm01_00037825 predicted 2952
4 SASI_Mm01_00037826 predicted 2543
5 SASI_Mm01_00037827 predicted 1750
6 SASI_Mm02_00349433 predicted 1066
7 SASI_Mm01_00037828 predicted 1027
8 SASI_Mm01_00037829 predicted 2285
9 SASI_Mm01_00037830 predicted 1908
10 SASI_Mm01_00037831 predicted 3330
11 SASI_Mm01_00037823 predicted 2942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002772
TMPRSS15 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.1-3423s1c1
Sequence:CCGGGCATATACCATACACTTAAGACTCGAGTCTTAAGTGTATGGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.1-3337s1c1
Sequence:CCGGCAGGTATTTCTTCACAGATCTCTCGAGAGATCTGTGAAGAAATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-1647s1c1
Sequence:CCGGCATTCAGTTCTACGAACTTTCCTCGAGGAAAGTTCGTAGAACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-2790s1c1
Sequence:CCGGCGGTTGTATATCAAGGTACTACTCGAGTAGTACCTTGATATACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002772.1-234s1c1
Sequence:CCGGCATCCGGAGTTACATATAATCCTCGAGGATTATATGTAACTCCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-615s1c1
Sequence:CCGGCTGATGCTCTAACGTGTATAACTCGAGTTATACACGTTAGAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-2651s1c1
Sequence:CCGGCGAAGAAAGGACAACGACATTCTCGAGAATGTCGTTGTCCTTTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-754s1c1
Sequence:CCGGCCAGGCTACTCATTATCCAAACTCGAGTTTGGATAATGAGTAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.x-3278s1c1
Sequence:CCGGCCATAGCAATACAGAATAACTCTCGAGAGTTATTCTGTATTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-1306s1c1
Sequence:CCGGCCTTAGTTTCTGGTATCATATCTCGAGATATGATACCAGAAACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-2720s1c1
Sequence:CCGGCCTATTTGTTTACCGGAAGAACTCGAGTTCTTCCGGTAAACAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002772
TMPRSS15 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.1-3423s1c1
Sequence:CCGGGCATATACCATACACTTAAGACTCGAGTCTTAAGTGTATGGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.1-3337s1c1
Sequence:CCGGCAGGTATTTCTTCACAGATCTCTCGAGAGATCTGTGAAGAAATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-1647s1c1
Sequence:CCGGCATTCAGTTCTACGAACTTTCCTCGAGGAAAGTTCGTAGAACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-2790s1c1
Sequence:CCGGCGGTTGTATATCAAGGTACTACTCGAGTAGTACCTTGATATACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002772.1-234s1c1
Sequence:CCGGCATCCGGAGTTACATATAATCCTCGAGGATTATATGTAACTCCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-615s1c1
Sequence:CCGGCTGATGCTCTAACGTGTATAACTCGAGTTATACACGTTAGAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-2651s1c1
Sequence:CCGGCGAAGAAAGGACAACGACATTCTCGAGAATGTCGTTGTCCTTTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-754s1c1
Sequence:CCGGCCAGGCTACTCATTATCCAAACTCGAGTTTGGATAATGAGTAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.x-3278s1c1
Sequence:CCGGCCATAGCAATACAGAATAACTCTCGAGAGTTATTCTGTATTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-1306s1c1
Sequence:CCGGCCTTAGTTTCTGGTATCATATCTCGAGATATGATACCAGAAACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-2720s1c1
Sequence:CCGGCCTATTTGTTTACCGGAAGAACTCGAGTTCTTCCGGTAAACAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002772
TMPRSS15 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.1-3423s1c1
Sequence:CCGGGCATATACCATACACTTAAGACTCGAGTCTTAAGTGTATGGTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.1-3337s1c1
Sequence:CCGGCAGGTATTTCTTCACAGATCTCTCGAGAGATCTGTGAAGAAATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-1647s1c1
Sequence:CCGGCATTCAGTTCTACGAACTTTCCTCGAGGAAAGTTCGTAGAACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-2790s1c1
Sequence:CCGGCGGTTGTATATCAAGGTACTACTCGAGTAGTACCTTGATATACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002772.1-234s1c1
Sequence:CCGGCATCCGGAGTTACATATAATCCTCGAGGATTATATGTAACTCCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.1-615s1c1
Sequence:CCGGCTGATGCTCTAACGTGTATAACTCGAGTTATACACGTTAGAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-2651s1c1
Sequence:CCGGCGAAGAAAGGACAACGACATTCTCGAGAATGTCGTTGTCCTTTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-754s1c1
Sequence:CCGGCCAGGCTACTCATTATCCAAACTCGAGTTTGGATAATGAGTAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002772.x-3278s1c1
Sequence:CCGGCCATAGCAATACAGAATAACTCTCGAGAGTTATTCTGTATTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-1306s1c1
Sequence:CCGGCCTTAGTTTCTGGTATCATATCTCGAGATATGATACCAGAAACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002772.x-2720s1c1
Sequence:CCGGCCTATTTGTTTACCGGAAGAACTCGAGTTCTTCCGGTAAACAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008941
TMPRSS15 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-700s1c1
Sequence:CCGGCCCTGTAACAACTTCAGATAACTCGAGTTATCTGAAGTTGTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-1069s1c1
Sequence:CCGGCCGATGGATCATCCGTGTAAACTCGAGTTTACACGGATGATCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-3341s1c1
Sequence:CCGGCGAGTCTCACAGTTTATAGAACTCGAGTTCTATAAACTGTGAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-2234s1c1
Sequence:CCGGCCCTGCCAAGATGACGAATTTCTCGAGAAATTCGTCATCTTGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-1782s1c1
Sequence:CCGGCCCTGGATGATATAAGCCTAACTCGAGTTAGGCTTATATCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-3232s21c1
Sequence:CCGGTGATTCTGGAGGGCCATTAATCTCGAGATTAATGGCCCTCCAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-1787s21c1
Sequence:CCGGGATGATATAAGCCTAACAAATCTCGAGATTTGTTAGGCTTATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-1761s21c1
Sequence:CCGGACCGAGGTTGCAGTACAATAGCTCGAGCTATTGTACTGCAACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008941
TMPRSS15 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-700s1c1
Sequence:CCGGCCCTGTAACAACTTCAGATAACTCGAGTTATCTGAAGTTGTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-1069s1c1
Sequence:CCGGCCGATGGATCATCCGTGTAAACTCGAGTTTACACGGATGATCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-3341s1c1
Sequence:CCGGCGAGTCTCACAGTTTATAGAACTCGAGTTCTATAAACTGTGAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-2234s1c1
Sequence:CCGGCCCTGCCAAGATGACGAATTTCTCGAGAAATTCGTCATCTTGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-1782s1c1
Sequence:CCGGCCCTGGATGATATAAGCCTAACTCGAGTTAGGCTTATATCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-3232s21c1
Sequence:CCGGTGATTCTGGAGGGCCATTAATCTCGAGATTAATGGCCCTCCAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-1787s21c1
Sequence:CCGGGATGATATAAGCCTAACAAATCTCGAGATTTGTTAGGCTTATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-1761s21c1
Sequence:CCGGACCGAGGTTGCAGTACAATAGCTCGAGCTATTGTACTGCAACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008941
TMPRSS15 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-700s1c1
Sequence:CCGGCCCTGTAACAACTTCAGATAACTCGAGTTATCTGAAGTTGTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-1069s1c1
Sequence:CCGGCCGATGGATCATCCGTGTAAACTCGAGTTTACACGGATGATCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-3341s1c1
Sequence:CCGGCGAGTCTCACAGTTTATAGAACTCGAGTTCTATAAACTGTGAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-2234s1c1
Sequence:CCGGCCCTGCCAAGATGACGAATTTCTCGAGAAATTCGTCATCTTGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008941.1-1782s1c1
Sequence:CCGGCCCTGGATGATATAAGCCTAACTCGAGTTAGGCTTATATCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-3232s21c1
Sequence:CCGGTGATTCTGGAGGGCCATTAATCTCGAGATTAATGGCCCTCCAGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-1787s21c1
Sequence:CCGGGATGATATAAGCCTAACAAATCTCGAGATTTGTTAGGCTTATATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008941.2-1761s21c1
Sequence:CCGGACCGAGGTTGCAGTACAATAGCTCGAGCTATTGTACTGCAACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks