EMAIL THIS PAGE TO A FRIEND

TMPRSS2

transmembrane protease, serine 2

Synonyms: PP9284 PRSS10
Gene ID:
Human(7113) Summary: This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(50528) transmembrane protease, serine 2
Rat(156435) transmembrane protease, serine 2
naked mole-rat(101715175) transmembrane protease, serine 2
domestic guinea pig(100732077) transmembrane protease, serine 2
cow(511037) transmembrane protease, serine 2
sheep(101120216) transmembrane protease, serine 2
Zebrafish(494080) transmembrane protease, serine 2
domestic cat(101096004) transmembrane protease, serine 2
chicken(418528) transmembrane protease, serine 2
dog(487770) transmembrane protease, serine 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005656 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036231 MISSION® esiRNA esiRNA human TMPRSS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005656 Rosetta Predictions human pricing
NM_130424 Rosetta Predictions rat pricing
NM_015775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072210 predicted 1540
2 SASI_Hs01_00072211 predicted 1372
3 SASI_Hs01_00072212 predicted 1360
4 SASI_Hs01_00072213 predicted 584
5 SASI_Hs01_00072214 predicted 1669
6 SASI_Hs01_00072215 predicted 1191
7 SASI_Hs01_00072216 predicted 833
8 SASI_Hs01_00072217 predicted 756
9 SASI_Hs01_00072218 predicted 1082
10 SASI_Hs01_00072219 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070713 predicted 243
2 SASI_Rn01_00070714 predicted 1514
3 SASI_Rn01_00070715 predicted 645
4 SASI_Rn01_00070716 predicted 573
5 SASI_Rn01_00070717 predicted 721
6 SASI_Rn01_00070718 predicted 1502
7 SASI_Rn01_00070719 predicted 1043
8 SASI_Rn01_00070720 predicted 1564
9 SASI_Rn01_00070722 predicted 1545
10 SASI_Rn02_00267426 predicted 1317
11 SASI_Rn01_00070721 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154894 predicted 1656
2 SASI_Mm01_00154895 predicted 378
3 SASI_Mm01_00154896 predicted 1475
4 SASI_Mm01_00154898 predicted 777
5 SASI_Mm01_00154899 predicted 986
6 SASI_Mm01_00154900 predicted 860
7 SASI_Mm01_00154901 predicted 1714
8 SASI_Mm01_00154902 predicted 1689
9 SASI_Mm01_00154903 predicted 1189
10 SASI_Mm02_00323117 predicted 697
11 SASI_Mm01_00154897 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015775
VALIDATED
TMPRSS2 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-876s21c1
Sequence:CCGGGGCAACGTTGACCTCTATAAACTCGAGTTTATAGAGGTCAACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1553s21c1
Sequence:CCGGGCCGCTGGTTACTTTGAAGAACTCGAGTTCTTCAAAGTAACCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1222s21c1
Sequence:CCGGCCCATCCAAATTACGACTCTACTCGAGTAGAGTCGTAATTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1645s21c1
Sequence:CCGGACGGGAACGTGACGGTATTTACTCGAGTAAATACCGTCACGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-404s21c1
Sequence:CCGGGCAAGCCTCAACATCTGTCATCTCGAGATGACAGATGTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-2761s1c1
Sequence:CCGGCCCTGGGTTTATACCAGGAAACTCGAGTTTCCTGGTATAAACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-1222s1c1
Sequence:CCGGCCCATCCAAATTACGACTCTACTCGAGTAGAGTCGTAATTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-404s1c1
Sequence:CCGGGCAAGCCTCAACATCTGTCATCTCGAGATGACAGATGTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-1553s1c1
Sequence:CCGGGCCGCTGGTTACTTTGAAGAACTCGAGTTCTTCAAAGTAACCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015775
VALIDATED
TMPRSS2 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-876s21c1
Sequence:CCGGGGCAACGTTGACCTCTATAAACTCGAGTTTATAGAGGTCAACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1553s21c1
Sequence:CCGGGCCGCTGGTTACTTTGAAGAACTCGAGTTCTTCAAAGTAACCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1222s21c1
Sequence:CCGGCCCATCCAAATTACGACTCTACTCGAGTAGAGTCGTAATTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1645s21c1
Sequence:CCGGACGGGAACGTGACGGTATTTACTCGAGTAAATACCGTCACGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-404s21c1
Sequence:CCGGGCAAGCCTCAACATCTGTCATCTCGAGATGACAGATGTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-2761s1c1
Sequence:CCGGCCCTGGGTTTATACCAGGAAACTCGAGTTTCCTGGTATAAACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-1222s1c1
Sequence:CCGGCCCATCCAAATTACGACTCTACTCGAGTAGAGTCGTAATTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-404s1c1
Sequence:CCGGGCAAGCCTCAACATCTGTCATCTCGAGATGACAGATGTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-1553s1c1
Sequence:CCGGGCCGCTGGTTACTTTGAAGAACTCGAGTTCTTCAAAGTAACCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015775
VALIDATED
TMPRSS2 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-876s21c1
Sequence:CCGGGGCAACGTTGACCTCTATAAACTCGAGTTTATAGAGGTCAACGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1553s21c1
Sequence:CCGGGCCGCTGGTTACTTTGAAGAACTCGAGTTCTTCAAAGTAACCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1222s21c1
Sequence:CCGGCCCATCCAAATTACGACTCTACTCGAGTAGAGTCGTAATTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-1645s21c1
Sequence:CCGGACGGGAACGTGACGGTATTTACTCGAGTAAATACCGTCACGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015775.2-404s21c1
Sequence:CCGGGCAAGCCTCAACATCTGTCATCTCGAGATGACAGATGTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-2761s1c1
Sequence:CCGGCCCTGGGTTTATACCAGGAAACTCGAGTTTCCTGGTATAAACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-1222s1c1
Sequence:CCGGCCCATCCAAATTACGACTCTACTCGAGTAGAGTCGTAATTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-404s1c1
Sequence:CCGGGCAAGCCTCAACATCTGTCATCTCGAGATGACAGATGTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015775.2-1553s1c1
Sequence:CCGGGCCGCTGGTTACTTTGAAGAACTCGAGTTCTTCAAAGTAACCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005656
VALIDATED
TMPRSS2 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-1565s21c1
Sequence:CCGGGATGGTATTCACGGACTGGATCTCGAGATCCAGTCCGTGAATACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-160s21c1
Sequence:CCGGCAGCTATTGGACCTTACTATGCTCGAGCATAGTAAGGTCCAATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005656.3-1701s21c1
Sequence:CCGGGATTCAGAGGTCACTTCATTTCTCGAGAAATGAAGTGACCTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005656.3-781s21c1
Sequence:CCGGCCGGCAATGTCGATATCTATACTCGAGTATAGATATCGACATTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-687s21c1
Sequence:CCGGTGCAGGGACATGGGCTATAAGCTCGAGCTTATAGCCCATGTCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-832s1c1
Sequence:CCGGAGTGGTTTCTTTACGCTGTATCTCGAGATACAGCGTAAAGAAACCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-774s1c1
Sequence:CCGGCCGGCAATGTCGATATCTATACTCGAGTATAGATATCGACATTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005656.x-1028s1c1
Sequence:CCGGCCTCTTAACAATCCATGGCATCTCGAGATGCCATGGATTGTTAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-1558s1c1
Sequence:CCGGGATGGTATTCACGGACTGGATCTCGAGATCCAGTCCGTGAATACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005656
VALIDATED
TMPRSS2 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-1565s21c1
Sequence:CCGGGATGGTATTCACGGACTGGATCTCGAGATCCAGTCCGTGAATACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-160s21c1
Sequence:CCGGCAGCTATTGGACCTTACTATGCTCGAGCATAGTAAGGTCCAATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005656.3-1701s21c1
Sequence:CCGGGATTCAGAGGTCACTTCATTTCTCGAGAAATGAAGTGACCTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005656.3-781s21c1
Sequence:CCGGCCGGCAATGTCGATATCTATACTCGAGTATAGATATCGACATTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-687s21c1
Sequence:CCGGTGCAGGGACATGGGCTATAAGCTCGAGCTTATAGCCCATGTCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-832s1c1
Sequence:CCGGAGTGGTTTCTTTACGCTGTATCTCGAGATACAGCGTAAAGAAACCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-774s1c1
Sequence:CCGGCCGGCAATGTCGATATCTATACTCGAGTATAGATATCGACATTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005656.x-1028s1c1
Sequence:CCGGCCTCTTAACAATCCATGGCATCTCGAGATGCCATGGATTGTTAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-1558s1c1
Sequence:CCGGGATGGTATTCACGGACTGGATCTCGAGATCCAGTCCGTGAATACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005656
VALIDATED
TMPRSS2 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-1565s21c1
Sequence:CCGGGATGGTATTCACGGACTGGATCTCGAGATCCAGTCCGTGAATACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-160s21c1
Sequence:CCGGCAGCTATTGGACCTTACTATGCTCGAGCATAGTAAGGTCCAATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005656.3-1701s21c1
Sequence:CCGGGATTCAGAGGTCACTTCATTTCTCGAGAAATGAAGTGACCTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005656.3-781s21c1
Sequence:CCGGCCGGCAATGTCGATATCTATACTCGAGTATAGATATCGACATTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005656.3-687s21c1
Sequence:CCGGTGCAGGGACATGGGCTATAAGCTCGAGCTTATAGCCCATGTCCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-832s1c1
Sequence:CCGGAGTGGTTTCTTTACGCTGTATCTCGAGATACAGCGTAAAGAAACCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-774s1c1
Sequence:CCGGCCGGCAATGTCGATATCTATACTCGAGTATAGATATCGACATTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005656.x-1028s1c1
Sequence:CCGGCCTCTTAACAATCCATGGCATCTCGAGATGCCATGGATTGTTAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005656.x-1558s1c1
Sequence:CCGGGATGGTATTCACGGACTGGATCTCGAGATCCAGTCCGTGAATACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks