EMAIL THIS PAGE TO A FRIEND

TMPRSS3

transmembrane protease, serine 3

Synonyms: DFNB10 DFNB8 ECHOS1 TADG12
UniProtKB ID: P57727, D3DSJ6, Q6ZMC3
Gene ID:
Human(64699) Summary: This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Mouse(140765) transmembrane protease, serine 3
Rat(309665) transmembrane protease, serine 3
chicken(427988) transmembrane protease, serine 3
Horse(100057972) transmembrane protease, serine 3
domestic cat(101094284) transmembrane protease, serine 3
dog(610987) transmembrane protease, serine 3
cow(537914) transmembrane protease, serine 3
sheep(101121487) transmembrane protease, serine 3
domestic guinea pig(100722410) transmembrane protease, serine 3
naked mole-rat(101709805) transmembrane protease, serine 3
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024022 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052701 MISSION® esiRNA esiRNA human TMPRSS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024022 Rosetta Predictions human pricing
NM_032401 Rosetta Predictions human pricing
NM_032404 Rosetta Predictions human pricing
NM_032405 Rosetta Predictions human pricing
NM_001107619 Rosetta Predictions rat pricing
NM_080727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058049 predicted 842
2 SASI_Hs01_00058050 predicted 702
3 SASI_Hs01_00058051 predicted 735
4 SASI_Hs01_00058052 predicted 637
5 SASI_Hs01_00058053 predicted 839
6 SASI_Hs01_00058054 predicted 769
7 SASI_Hs01_00058055 predicted 740
8 SASI_Hs01_00058056 predicted 754
9 SASI_Hs01_00058057 predicted 843
10 SASI_Hs01_00058058 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131625 predicted 928
2 SASI_Hs01_00131626 predicted 786
3 SASI_Hs01_00131627 predicted 819
4 SASI_Hs01_00131628 predicted 727
5 SASI_Hs01_00131629 predicted 923
6 SASI_Hs01_00131630 predicted 854
7 SASI_Hs01_00131631 predicted 822
8 SASI_Hs01_00131632 predicted 839
9 SASI_Hs01_00131633 predicted 925
10 SASI_Hs01_00131634 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214318 predicted 511
2 SASI_Hs01_00214319 predicted 361
3 SASI_Hs01_00214320 predicted 404
4 SASI_Hs01_00214322 predicted 309
5 SASI_Hs01_00214323 predicted 505
6 SASI_Hs01_00214324 predicted 438
7 SASI_Hs02_00359794 predicted 380
8 SASI_Hs01_00214325 predicted 411
9 SASI_Hs01_00214326 predicted 416
10 SASI_Hs01_00214327 predicted 505
11 SASI_Hs01_00214321 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166284 predicted 841
2 SASI_Hs01_00166285 predicted 697
3 SASI_Hs01_00166286 predicted 733
4 SASI_Hs01_00166287 predicted 634
5 SASI_Hs01_00166288 predicted 842
6 SASI_Hs02_00359795 predicted 711
7 SASI_Hs01_00166290 predicted 741
8 SASI_Hs01_00166291 predicted 753
9 SASI_Hs01_00166292 predicted 842
10 SASI_Hs01_00166293 predicted 632
11 SASI_Hs01_00166289 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230615 predicted 1166
2 SASI_Rn02_00230616 predicted 958
3 SASI_Rn02_00230617 predicted 1035
4 SASI_Rn02_00230618 predicted 288
5 SASI_Rn02_00230619 predicted 195
6 SASI_Rn02_00230620 predicted 593
7 SASI_Rn02_00230621 predicted 1287
8 SASI_Rn02_00230622 predicted 295
9 SASI_Rn02_00230623 predicted 384
10 SASI_Rn02_00230624 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186875 predicted 1291
2 SASI_Mm01_00186876 predicted 1504
3 SASI_Mm01_00186877 predicted 287
4 SASI_Mm01_00186878 predicted 203
5 SASI_Mm01_00186879 predicted 1171
6 SASI_Mm01_00186880 predicted 1285
7 SASI_Mm01_00186882 predicted 694
8 SASI_Mm01_00186883 predicted 822
9 SASI_Mm01_00186884 predicted 384
10 SASI_Mm02_00338199 predicted 1038
11 SASI_Mm01_00186881 predicted 1330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080727
TMPRSS3 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-1031s1c1
Sequence:CCGGCCCAACTCTGAAGAGAACTTTCTCGAGAAAGTTCTCTTCAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-574s1c1
Sequence:CCGGTCACCTCTTGTCAGATGACAACTCGAGTTGTCATCTGACAAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-902s1c1
Sequence:CCGGCCCTCCCATTTGGTGGAGAAACTCGAGTTTCTCCACCAAATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-1342s1c1
Sequence:CCGGGCCTGGAGTCTATACGCGAATCTCGAGATTCGCGTATAGACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-292s1c1
Sequence:CCGGCCATTCATCTTTCAAGTGTATCTCGAGATACACTTGAAAGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080727
TMPRSS3 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-1031s1c1
Sequence:CCGGCCCAACTCTGAAGAGAACTTTCTCGAGAAAGTTCTCTTCAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-574s1c1
Sequence:CCGGTCACCTCTTGTCAGATGACAACTCGAGTTGTCATCTGACAAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-902s1c1
Sequence:CCGGCCCTCCCATTTGGTGGAGAAACTCGAGTTTCTCCACCAAATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-1342s1c1
Sequence:CCGGGCCTGGAGTCTATACGCGAATCTCGAGATTCGCGTATAGACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-292s1c1
Sequence:CCGGCCATTCATCTTTCAAGTGTATCTCGAGATACACTTGAAAGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080727
TMPRSS3 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-1031s1c1
Sequence:CCGGCCCAACTCTGAAGAGAACTTTCTCGAGAAAGTTCTCTTCAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-574s1c1
Sequence:CCGGTCACCTCTTGTCAGATGACAACTCGAGTTGTCATCTGACAAGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-902s1c1
Sequence:CCGGCCCTCCCATTTGGTGGAGAAACTCGAGTTTCTCCACCAAATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-1342s1c1
Sequence:CCGGGCCTGGAGTCTATACGCGAATCTCGAGATTCGCGTATAGACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080727.1-292s1c1
Sequence:CCGGCCATTCATCTTTCAAGTGTATCTCGAGATACACTTGAAAGATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024022
TMPRSS3 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-1284s1c1
Sequence:CCGGCGTCCCTTTGATTTCCAACAACTCGAGTTGTTGGAAATCAAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-748s1c1
Sequence:CCGGGCATTACACCACTCAGTATATCTCGAGATATACTGAGTGGTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-631s1c1
Sequence:CCGGCAACTGGGTTTCCCAAGCTATCTCGAGATAGCTTGGGAAACCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-236s1c1
Sequence:CCGGCCTTCTCATTCCGATCGCTTTCTCGAGAAAGCGATCGGAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-1137s1c1
Sequence:CCGGGCCACTCACGTTCAATGAAATCTCGAGATTTCATTGAACGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-439s21c1
Sequence:CCGGCGCTCATCCTTTAAGTGTATCCTCGAGGATACACTTAAAGGATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-1022s21c1
Sequence:CCGGTAGTTTCCCTGTTGGACAATCCTCGAGGATTGTCCAACAGGGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-364s21c1
Sequence:CCGGGGGATCATTGCATTGATATTACTCGAGTAATATCAATGCAATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024022
TMPRSS3 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-1284s1c1
Sequence:CCGGCGTCCCTTTGATTTCCAACAACTCGAGTTGTTGGAAATCAAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-748s1c1
Sequence:CCGGGCATTACACCACTCAGTATATCTCGAGATATACTGAGTGGTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-631s1c1
Sequence:CCGGCAACTGGGTTTCCCAAGCTATCTCGAGATAGCTTGGGAAACCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-236s1c1
Sequence:CCGGCCTTCTCATTCCGATCGCTTTCTCGAGAAAGCGATCGGAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-1137s1c1
Sequence:CCGGGCCACTCACGTTCAATGAAATCTCGAGATTTCATTGAACGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-439s21c1
Sequence:CCGGCGCTCATCCTTTAAGTGTATCCTCGAGGATACACTTAAAGGATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-1022s21c1
Sequence:CCGGTAGTTTCCCTGTTGGACAATCCTCGAGGATTGTCCAACAGGGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-364s21c1
Sequence:CCGGGGGATCATTGCATTGATATTACTCGAGTAATATCAATGCAATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024022
TMPRSS3 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-1284s1c1
Sequence:CCGGCGTCCCTTTGATTTCCAACAACTCGAGTTGTTGGAAATCAAAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-748s1c1
Sequence:CCGGGCATTACACCACTCAGTATATCTCGAGATATACTGAGTGGTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-631s1c1
Sequence:CCGGCAACTGGGTTTCCCAAGCTATCTCGAGATAGCTTGGGAAACCCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-236s1c1
Sequence:CCGGCCTTCTCATTCCGATCGCTTTCTCGAGAAAGCGATCGGAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024022.1-1137s1c1
Sequence:CCGGGCCACTCACGTTCAATGAAATCTCGAGATTTCATTGAACGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-439s21c1
Sequence:CCGGCGCTCATCCTTTAAGTGTATCCTCGAGGATACACTTAAAGGATGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-1022s21c1
Sequence:CCGGTAGTTTCCCTGTTGGACAATCCTCGAGGATTGTCCAACAGGGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024022.2-364s21c1
Sequence:CCGGGGGATCATTGCATTGATATTACTCGAGTAATATCAATGCAATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks