EMAIL THIS PAGE TO A FRIEND

TMPRSS4

transmembrane protease, serine 4

Synonyms: CAPH2 MT-SP2 TMPRSS3
UniProtKB ID: Q9NRS4, A8MU84, B0YJB0, Q5XKQ6, Q6UX37, Q9NZA5
Gene ID:
Human(56649) Summary: This gene encodes a member of the serine protease family. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified as a gene overexpressed in pancreatic carcinoma. The encoded protein is membrane bound with a N-terminal anchor sequence and a glycosylated extracellular region containing the serine protease domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(214523) transmembrane protease, serine 4
Rat(367074) transmembrane protease, serine 4
chicken(770454) transmembrane protease, serine 4
dog(489387) transmembrane protease, serine 4
Horse(100071190) transmembrane protease, serine 4
domestic cat(101082848) transmembrane protease, serine 4
naked mole-rat(101707398) transmembrane protease, serine 4
Domestic Rabbit(100355162) transmembrane protease, serine 4
domestic guinea pig(100728893) transmembrane protease, serine 4
cow(513343) transmembrane protease, serine 4
sheep(101121197) transmembrane protease, serine 4
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083947 Rosetta Predictions human pricing
NM_019894 Rosetta Predictions human pricing
NM_183247 Rosetta Predictions human pricing
NM_001108998 Rosetta Predictions rat pricing
NM_145403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317341 predicted 2044
2 SASI_Hs02_00317342 predicted 1879
3 SASI_Hs02_00317343 predicted 2004
4 SASI_Hs02_00317344 predicted 1728
5 SASI_Hs02_00317345 predicted 314
6 SASI_Hs02_00317346 predicted 2058
7 SASI_Hs02_00317347 predicted 1541
8 SASI_Hs02_00317348 predicted 2011
9 SASI_Hs02_00317349 predicted 1016
10 SASI_Hs02_00317350 predicted 2086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352909 predicted 2059
2 SASI_Hs02_00352910 predicted 1887
3 SASI_Hs02_00352911 predicted 2018
4 SASI_Hs02_00352912 predicted 1741
5 SASI_Hs02_00352913 predicted 315
6 SASI_Hs02_00352914 predicted 2073
7 SASI_Hs02_00352915 predicted 1552
8 SASI_Hs02_00352916 predicted 2028
9 SASI_Hs01_00094985 predicted 1033
10 SASI_Hs02_00352917 predicted 2099
11 SASI_Hs01_00094978 predicted 771
12 SASI_Hs01_00094979 predicted 785
13 SASI_Hs01_00094980 predicted 622
14 SASI_Hs01_00094981 predicted 1814
15 SASI_Hs01_00094982 predicted 681
16 SASI_Hs01_00094983 predicted 656
17 SASI_Hs01_00094984 predicted 741
18 SASI_Hs01_00094986 predicted 774
19 SASI_Hs01_00094987 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049564 predicted 768
2 SASI_Hs01_00049565 predicted 772
3 SASI_Hs01_00049566 predicted 618
4 SASI_Hs01_00049567 predicted 1666
5 SASI_Hs01_00049568 predicted 673
6 SASI_Hs01_00049569 predicted 657
7 SASI_Hs01_00049570 predicted 733
8 SASI_Hs01_00049571 predicted 991
9 SASI_Hs01_00049572 predicted 758
10 SASI_Hs01_00049573 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244164 predicted 527
2 SASI_Rn02_00244165 predicted 396
3 SASI_Rn02_00244166 predicted 1656
4 SASI_Rn02_00244167 predicted 764
5 SASI_Rn02_00244168 predicted 406
6 SASI_Rn02_00244169 predicted 480
7 SASI_Rn02_00244170 predicted 896
8 SASI_Rn02_00244171 predicted 1526
9 SASI_Rn02_00244172 predicted 375
10 SASI_Rn02_00244173 predicted 1613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047987 predicted 550
2 SASI_Mm01_00047988 predicted 1036
3 SASI_Mm01_00047989 predicted 1059
4 SASI_Mm01_00047990 predicted 1093
5 SASI_Mm01_00047992 predicted 435
6 SASI_Mm01_00047993 predicted 1310
7 SASI_Mm01_00047994 predicted 1281
8 SASI_Mm01_00047995 predicted 1676
9 SASI_Mm01_00047996 predicted 784
10 SASI_Mm02_00340736 predicted 497
11 SASI_Mm01_00047991 predicted 1805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019894
TMPRSS4 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019894.3-2063s21c1
Sequence:CCGGTGTTGGTATGACTACCGTTACCTCGAGGTAACGGTAGTCATACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019894.2-1972s1c1
Sequence:CCGGCCAAGCCTACTAGAGCAAGAACTCGAGTTCTTGCTCTAGTAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-382s1c1
Sequence:CCGGGCGAGTATCATCATTGTGGTTCTCGAGAACCACAATGATGATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-910s1c1
Sequence:CCGGGTCAGCATCCAGTACGACAAACTCGAGTTTGTCGTACTGGATGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-1356s1c1
Sequence:CCGGGAAGATGATGTGTGCAGGCATCTCGAGATGCCTGCACACATCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-983s1c1
Sequence:CCGGCCCACTGCTTCAGGAAACATACTCGAGTATGTTTCCTGAAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019894.3-771s21c1
Sequence:CCGGGGATCTGGATGTTGTTGAAATCTCGAGATTTCAACAACATCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019894
TMPRSS4 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019894.3-2063s21c1
Sequence:CCGGTGTTGGTATGACTACCGTTACCTCGAGGTAACGGTAGTCATACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019894.2-1972s1c1
Sequence:CCGGCCAAGCCTACTAGAGCAAGAACTCGAGTTCTTGCTCTAGTAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-382s1c1
Sequence:CCGGGCGAGTATCATCATTGTGGTTCTCGAGAACCACAATGATGATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-910s1c1
Sequence:CCGGGTCAGCATCCAGTACGACAAACTCGAGTTTGTCGTACTGGATGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-1356s1c1
Sequence:CCGGGAAGATGATGTGTGCAGGCATCTCGAGATGCCTGCACACATCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-983s1c1
Sequence:CCGGCCCACTGCTTCAGGAAACATACTCGAGTATGTTTCCTGAAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019894.3-771s21c1
Sequence:CCGGGGATCTGGATGTTGTTGAAATCTCGAGATTTCAACAACATCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019894
TMPRSS4 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019894.3-2063s21c1
Sequence:CCGGTGTTGGTATGACTACCGTTACCTCGAGGTAACGGTAGTCATACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019894.2-1972s1c1
Sequence:CCGGCCAAGCCTACTAGAGCAAGAACTCGAGTTCTTGCTCTAGTAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-382s1c1
Sequence:CCGGGCGAGTATCATCATTGTGGTTCTCGAGAACCACAATGATGATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-910s1c1
Sequence:CCGGGTCAGCATCCAGTACGACAAACTCGAGTTTGTCGTACTGGATGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-1356s1c1
Sequence:CCGGGAAGATGATGTGTGCAGGCATCTCGAGATGCCTGCACACATCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019894.2-983s1c1
Sequence:CCGGCCCACTGCTTCAGGAAACATACTCGAGTATGTTTCCTGAAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019894.3-771s21c1
Sequence:CCGGGGATCTGGATGTTGTTGAAATCTCGAGATTTCAACAACATCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145403
TMPRSS4 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145403.2-2005s21c1
Sequence:CCGGAGTTCTAATGTAAGGTGTATACTCGAGTATACACCTTACATTAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145403.2-1930s21c1
Sequence:CCGGGATGAGACAAGGGTATGAAAGCTCGAGCTTTCATACCCTTGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145403.1-1870s1c1
Sequence:CCGGCCTTCCACTGAAGGAAGGAAACTCGAGTTTCCTTCCTTCAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-1287s1c1
Sequence:CCGGCGGAGGAAAGATGTCTGACATCTCGAGATGTCAGACATCTTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-430s1c1
Sequence:CCGGGCCCTTCTCATCAAGGTGATTCTCGAGAATCACCTTGATGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-654s1c1
Sequence:CCGGCTCAGTCTGTTTCGACAACTTCTCGAGAAGTTGTCGAAACAGACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-1102s1c1
Sequence:CCGGGCCAAGATCTTCATCGCTGAACTCGAGTTCAGCGATGAAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145403
TMPRSS4 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145403.2-2005s21c1
Sequence:CCGGAGTTCTAATGTAAGGTGTATACTCGAGTATACACCTTACATTAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145403.2-1930s21c1
Sequence:CCGGGATGAGACAAGGGTATGAAAGCTCGAGCTTTCATACCCTTGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145403.1-1870s1c1
Sequence:CCGGCCTTCCACTGAAGGAAGGAAACTCGAGTTTCCTTCCTTCAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-1287s1c1
Sequence:CCGGCGGAGGAAAGATGTCTGACATCTCGAGATGTCAGACATCTTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-430s1c1
Sequence:CCGGGCCCTTCTCATCAAGGTGATTCTCGAGAATCACCTTGATGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-654s1c1
Sequence:CCGGCTCAGTCTGTTTCGACAACTTCTCGAGAAGTTGTCGAAACAGACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-1102s1c1
Sequence:CCGGGCCAAGATCTTCATCGCTGAACTCGAGTTCAGCGATGAAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145403
TMPRSS4 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145403.2-2005s21c1
Sequence:CCGGAGTTCTAATGTAAGGTGTATACTCGAGTATACACCTTACATTAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145403.2-1930s21c1
Sequence:CCGGGATGAGACAAGGGTATGAAAGCTCGAGCTTTCATACCCTTGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145403.1-1870s1c1
Sequence:CCGGCCTTCCACTGAAGGAAGGAAACTCGAGTTTCCTTCCTTCAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-1287s1c1
Sequence:CCGGCGGAGGAAAGATGTCTGACATCTCGAGATGTCAGACATCTTTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-430s1c1
Sequence:CCGGGCCCTTCTCATCAAGGTGATTCTCGAGAATCACCTTGATGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-654s1c1
Sequence:CCGGCTCAGTCTGTTTCGACAACTTCTCGAGAAGTTGTCGAAACAGACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145403.1-1102s1c1
Sequence:CCGGGCCAAGATCTTCATCGCTGAACTCGAGTTCAGCGATGAAGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks