EMAIL THIS PAGE TO A FRIEND

TMPRSS5

transmembrane protease, serine 5

Synonyms: SPINESIN
UniProtKB ID: Q9H3S3
Gene ID:
Human(80975) Summary: This gene encodes a protein that belongs to the serine protease family. Serine proteases are known to be involved in many physiological and pathological processes. [provided by RefSeq, Jul 2008]
Mouse(80893) transmembrane protease, serine 5 (spinesin)
Rat(266681) transmembrane protease, serine 5
chicken(100859234) transmembrane protease, serine 5
Horse(100070705) transmembrane protease, serine 5
domestic cat(101082088) transmembrane protease, serine 5
dog(611247) transmembrane protease, serine 5
cow(615090) transmembrane protease, serine 5
sheep(101109737) transmembrane protease, serine 5
domestic guinea pig(100713668) transmembrane protease, serine 5
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030770 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030770 Rosetta Predictions human pricing
NM_153311 Rosetta Predictions rat pricing
NM_030709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176650 predicted 1181
2 SASI_Hs01_00176651 predicted 599
3 SASI_Hs01_00176652 predicted 600
4 SASI_Hs02_00358313 predicted 1493
5 SASI_Hs01_00176653 predicted 470
6 SASI_Hs01_00176654 predicted 885
7 SASI_Hs01_00176655 predicted 1559
8 SASI_Hs02_00358314 predicted 451
9 SASI_Hs01_00176656 predicted 637
10 SASI_Hs01_00176657 predicted 1704
11 SASI_Hs01_00176658 predicted 801
12 SASI_Hs01_00176659 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035511 predicted 387
2 SASI_Rn01_00035512 predicted 392
3 SASI_Rn01_00035513 predicted 666
4 SASI_Rn01_00035514 predicted 259
5 SASI_Rn01_00035515 predicted 1014
6 SASI_Rn01_00035516 predicted 849
7 SASI_Rn02_00268960 predicted 553
8 SASI_Rn01_00035517 predicted 845
9 SASI_Rn01_00035519 predicted 1144
10 SASI_Rn01_00035520 predicted 665
11 SASI_Rn01_00035518 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125439 predicted 535
2 SASI_Mm01_00125440 predicted 282
3 SASI_Mm01_00125441 predicted 409
4 SASI_Mm01_00125442 predicted 273
5 SASI_Mm01_00125444 predicted 672
6 SASI_Mm01_00125445 predicted 533
7 SASI_Mm01_00125446 predicted 1225
8 SASI_Mm02_00336892 predicted 958
9 SASI_Mm01_00125447 predicted 642
10 SASI_Mm01_00125448 predicted 565
11 SASI_Mm01_00125443 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030709
TMPRSS5 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-681s1c1
Sequence:CCGGGCCGAATTGTTTCTCTCAAATCTCGAGATTTGAGAGAAACAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-1143s1c1
Sequence:CCGGGCCATACTCATAGCTCAGATACTCGAGTATCTGAGCTATGAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-989s1c1
Sequence:CCGGGCCCAGAACCATGACTATGATCTCGAGATCATAGTCATGGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-722s1c1
Sequence:CCGGCCTCTGGCTTCTCGAATAGTTCTCGAGAACTATTCGAGAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-281s1c1
Sequence:CCGGTGGCTCTTAGTGTTGTATCTACTCGAGTAGATACAACACTAAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030709
TMPRSS5 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-681s1c1
Sequence:CCGGGCCGAATTGTTTCTCTCAAATCTCGAGATTTGAGAGAAACAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-1143s1c1
Sequence:CCGGGCCATACTCATAGCTCAGATACTCGAGTATCTGAGCTATGAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-989s1c1
Sequence:CCGGGCCCAGAACCATGACTATGATCTCGAGATCATAGTCATGGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-722s1c1
Sequence:CCGGCCTCTGGCTTCTCGAATAGTTCTCGAGAACTATTCGAGAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-281s1c1
Sequence:CCGGTGGCTCTTAGTGTTGTATCTACTCGAGTAGATACAACACTAAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030709
TMPRSS5 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-681s1c1
Sequence:CCGGGCCGAATTGTTTCTCTCAAATCTCGAGATTTGAGAGAAACAATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-1143s1c1
Sequence:CCGGGCCATACTCATAGCTCAGATACTCGAGTATCTGAGCTATGAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-989s1c1
Sequence:CCGGGCCCAGAACCATGACTATGATCTCGAGATCATAGTCATGGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-722s1c1
Sequence:CCGGCCTCTGGCTTCTCGAATAGTTCTCGAGAACTATTCGAGAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030709.1-281s1c1
Sequence:CCGGTGGCTCTTAGTGTTGTATCTACTCGAGTAGATACAACACTAAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030770
TMPRSS5 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-403s1c1
Sequence:CCGGCCTTGCAGGATGAGGAGATAACTCGAGTTATCTCCTCATCCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-751s1c1
Sequence:CCGGGTCAAGTTGTTTCCCTCAGATCTCGAGATCTGAGGGAAACAACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-742s1c1
Sequence:CCGGGCACTTCTGGTCAAGTTGTTTCTCGAGAAACAACTTGACCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-1214s1c1
Sequence:CCGGCCATACTTACAGCTCGGATATCTCGAGATATCCGAGCTGTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030770.1-1717s1c1
Sequence:CCGGCCCTGATTTCAGAGTCCTCTTCTCGAGAAGAGGACTCTGAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030770
TMPRSS5 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-403s1c1
Sequence:CCGGCCTTGCAGGATGAGGAGATAACTCGAGTTATCTCCTCATCCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-751s1c1
Sequence:CCGGGTCAAGTTGTTTCCCTCAGATCTCGAGATCTGAGGGAAACAACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-742s1c1
Sequence:CCGGGCACTTCTGGTCAAGTTGTTTCTCGAGAAACAACTTGACCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-1214s1c1
Sequence:CCGGCCATACTTACAGCTCGGATATCTCGAGATATCCGAGCTGTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030770.1-1717s1c1
Sequence:CCGGCCCTGATTTCAGAGTCCTCTTCTCGAGAAGAGGACTCTGAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030770
TMPRSS5 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-403s1c1
Sequence:CCGGCCTTGCAGGATGAGGAGATAACTCGAGTTATCTCCTCATCCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-751s1c1
Sequence:CCGGGTCAAGTTGTTTCCCTCAGATCTCGAGATCTGAGGGAAACAACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-742s1c1
Sequence:CCGGGCACTTCTGGTCAAGTTGTTTCTCGAGAAACAACTTGACCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030770.1-1214s1c1
Sequence:CCGGCCATACTTACAGCTCGGATATCTCGAGATATCCGAGCTGTAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030770.1-1717s1c1
Sequence:CCGGCCCTGATTTCAGAGTCCTCTTCTCGAGAAGAGGACTCTGAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks