EMAIL THIS PAGE TO A FRIEND

TMPRSS6

transmembrane protease, serine 6

Synonyms: IRIDA
Gene ID:
Human(164656) Summary: The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. [provided by RefSeq, Jul 2008]
Mouse(71753) transmembrane serine protease 6
Rat(315388) transmembrane protease, serine 6
domestic guinea pig(100730361) transmembrane protease, serine 6
naked mole-rat(101726737) transmembrane protease, serine 6
cow(614844) transmembrane protease, serine 6
sheep(101102553) transmembrane protease, serine 6
chicken(418046) transmembrane protease, serine 6
dog(608593) transmembrane protease, serine 6
domestic cat(101092375) transmembrane protease, serine 6
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108747 Anti-TMPRSS6 affinity isolated antibody pig, canine, horse, guinea pig, bovine, bovine, mouse, human
immunohistochemistry, western blot pricing
SAB4301850 Anti-TMPRSS6 affinity isolated antibody human
immunohistochemistry pricing
SAB1408403 Anti-TMPRSS6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103628 Anti-TMPRSS6, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, human, horse, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153019 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066811 MISSION® esiRNA esiRNA targeting mouse Tmprss6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153609 Rosetta Predictions human pricing
NM_001130556 Rosetta Predictions rat pricing
NM_027902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070742 predicted 744
2 SASI_Hs01_00070743 predicted 415
3 SASI_Hs01_00070744 predicted 1566
4 SASI_Hs01_00070745 predicted 2476
5 SASI_Hs01_00070746 predicted 1703
6 SASI_Hs01_00070747 predicted 432
7 SASI_Hs01_00070748 predicted 1248
8 SASI_Hs01_00070749 predicted 709
9 SASI_Hs01_00070750 predicted 1250
10 SASI_Hs02_00367340 predicted 1597
11 SASI_Hs01_00070751 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255729 predicted 523
2 SASI_Rn02_00255730 predicted 760
3 SASI_Rn02_00255731 predicted 2399
4 SASI_Rn02_00255732 predicted 1052
5 SASI_Rn02_00255733 predicted 1550
6 SASI_Rn02_00255734 predicted 2035
7 SASI_Rn02_00255735 predicted 1791
8 SASI_Rn02_00255736 predicted 1740
9 SASI_Rn02_00255737 predicted 2140
10 SASI_Rn02_00255738 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147592 predicted 770
2 SASI_Mm01_00147593 predicted 529
3 SASI_Mm01_00147594 predicted 829
4 SASI_Mm01_00147595 predicted 1888
5 SASI_Mm01_00147598 predicted 1755
6 SASI_Mm01_00147599 predicted 2142
7 SASI_Mm01_00147600 predicted 1053
8 SASI_Mm01_00147601 predicted 2577
9 SASI_Mm02_00332876 predicted 1554
10 SASI_Mm02_00332877 predicted 1274
11 SASI_Mm01_00147596 predicted 1563
12 SASI_Mm01_00147597 predicted 2012
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153019
TMPRSS6 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-393s1c1
Sequence:CCGGGCGTGTACTCAATCGCCACTTCTCGAGAAGTGGCGATTGAGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-506s1c1
Sequence:CCGGGCCTGGGAACTTACTACAACTCTCGAGAGTTGTAGTAAGTTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-570s1c1
Sequence:CCGGCTTCTGGTTCATTCTCCAAATCTCGAGATTTGGAGAATGAACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-733s1c1
Sequence:CCGGGAAGCCAGTGTGAAAGACATACTCGAGTATGTCTTTCACACTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-1281s1c1
Sequence:CCGGGAGGAGGCAGAAGTATGATTTCTCGAGAAATCATACTTCTGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153019
TMPRSS6 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-393s1c1
Sequence:CCGGGCGTGTACTCAATCGCCACTTCTCGAGAAGTGGCGATTGAGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-506s1c1
Sequence:CCGGGCCTGGGAACTTACTACAACTCTCGAGAGTTGTAGTAAGTTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-570s1c1
Sequence:CCGGCTTCTGGTTCATTCTCCAAATCTCGAGATTTGGAGAATGAACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-733s1c1
Sequence:CCGGGAAGCCAGTGTGAAAGACATACTCGAGTATGTCTTTCACACTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-1281s1c1
Sequence:CCGGGAGGAGGCAGAAGTATGATTTCTCGAGAAATCATACTTCTGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153019
TMPRSS6 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-393s1c1
Sequence:CCGGGCGTGTACTCAATCGCCACTTCTCGAGAAGTGGCGATTGAGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-506s1c1
Sequence:CCGGGCCTGGGAACTTACTACAACTCTCGAGAGTTGTAGTAAGTTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-570s1c1
Sequence:CCGGCTTCTGGTTCATTCTCCAAATCTCGAGATTTGGAGAATGAACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-733s1c1
Sequence:CCGGGAAGCCAGTGTGAAAGACATACTCGAGTATGTCTTTCACACTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153019.2-1281s1c1
Sequence:CCGGGAGGAGGCAGAAGTATGATTTCTCGAGAAATCATACTTCTGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027902
TMPRSS6 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-621s1c1
Sequence:CCGGGCTTCCTATAAGACCGAATATCTCGAGATATTCGGTCTTATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-275s1c1
Sequence:CCGGGCTTTGGTATTTCCTAGGGTACTCGAGTACCCTAGGAAATACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-1391s1c1
Sequence:CCGGGCAAGTGTACTACAGCTTGTACTCGAGTACAAGCTGTAGTACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-2426s1c1
Sequence:CCGGACCCAATTTCTTTGGCGTCTACTCGAGTAGACGCCAAAGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-1126s1c1
Sequence:CCGGCCAGTTACTACTCTCCCAGTACTCGAGTACTGGGAGAGTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027902
TMPRSS6 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-621s1c1
Sequence:CCGGGCTTCCTATAAGACCGAATATCTCGAGATATTCGGTCTTATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-275s1c1
Sequence:CCGGGCTTTGGTATTTCCTAGGGTACTCGAGTACCCTAGGAAATACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-1391s1c1
Sequence:CCGGGCAAGTGTACTACAGCTTGTACTCGAGTACAAGCTGTAGTACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-2426s1c1
Sequence:CCGGACCCAATTTCTTTGGCGTCTACTCGAGTAGACGCCAAAGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-1126s1c1
Sequence:CCGGCCAGTTACTACTCTCCCAGTACTCGAGTACTGGGAGAGTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027902
TMPRSS6 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-621s1c1
Sequence:CCGGGCTTCCTATAAGACCGAATATCTCGAGATATTCGGTCTTATAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-275s1c1
Sequence:CCGGGCTTTGGTATTTCCTAGGGTACTCGAGTACCCTAGGAAATACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-1391s1c1
Sequence:CCGGGCAAGTGTACTACAGCTTGTACTCGAGTACAAGCTGTAGTACACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-2426s1c1
Sequence:CCGGACCCAATTTCTTTGGCGTCTACTCGAGTAGACGCCAAAGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027902.1-1126s1c1
Sequence:CCGGCCAGTTACTACTCTCCCAGTACTCGAGTACTGGGAGAGTAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks