EMAIL THIS PAGE TO A FRIEND

TMPRSS7

transmembrane protease, serine 7

UniProtKB ID: Q7RTY8, C9J8P7, E9PAS3, Q17RH4
Gene ID:
Mouse(208171) transmembrane serine protease 7
Rat(288118) transmembrane protease, serine 7
chicken(769974) transmembrane protease, serine 7
domestic cat(101087773) transmembrane protease, serine 7
Horse(100061476) transmembrane protease, serine 7
dog(487973) transmembrane protease, serine 7
cow(522055) transmembrane protease, serine 7
sheep(101120035) transmembrane protease, serine 7
naked mole-rat(101700207) transmembrane protease, serine 7
Domestic Rabbit(100349681) transmembrane protease, serine 7
domestic guinea pig(100731737) transmembrane protease, serine 7
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042575 Rosetta Predictions human pricing
XM_293599 Rosetta Predictions human pricing
XM_928135 Rosetta Predictions human pricing
NM_001105882 Rosetta Predictions rat pricing
NM_172455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310618 predicted 1564
2 SASI_Hs02_00310619 predicted 910
3 SASI_Hs02_00310620 predicted 2258
4 SASI_Hs02_00310621 predicted 897
5 SASI_Hs02_00310622 predicted 2187
6 SASI_Hs02_00310623 predicted 1135
7 SASI_Hs02_00310624 predicted 1646
8 SASI_Hs02_00310625 predicted 2246
9 SASI_Hs02_00310626 predicted 1292
10 SASI_Hs02_00310627 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283560 predicted 1401
2 SASI_Hs01_00283561 predicted 1564
3 SASI_Hs01_00283562 predicted 2259
4 SASI_Hs01_00283563 predicted 2181
5 SASI_Hs01_00283564 predicted 1126
6 SASI_Hs01_00283565 predicted 2280
7 SASI_Hs01_00283566 predicted 1643
8 SASI_Hs01_00283567 predicted 2247
9 SASI_Hs01_00283568 predicted 1292
10 SASI_Hs01_00283569 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261692 predicted 1156
2 SASI_Hs01_00261693 predicted 1315
3 SASI_Hs01_00261694 predicted 1780
4 SASI_Hs01_00261695 predicted 1069
5 SASI_Hs01_00261696 predicted 1692
6 SASI_Hs01_00261697 predicted 1077
7 SASI_Hs01_00261698 predicted 1404
8 SASI_Hs01_00261699 predicted 850
9 SASI_Hs01_00261700 predicted 874
10 SASI_Hs01_00261701 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213462 predicted 333
2 SASI_Rn02_00213463 predicted 336
3 SASI_Rn02_00213464 predicted 340
4 SASI_Rn02_00213465 predicted 345
5 SASI_Rn02_00213466 predicted 336
6 SASI_Rn02_00213467 predicted 354
7 SASI_Rn02_00213468 predicted 377
8 SASI_Rn02_00213469 predicted 308
9 SASI_Rn02_00213470 predicted 379
10 SASI_Rn02_00213471 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343973 predicted 665
2 SASI_Mm01_00041394 predicted 725
3 SASI_Mm01_00041395 predicted 698
4 SASI_Mm01_00041396 predicted 1722
5 SASI_Mm01_00041397 predicted 1224
6 SASI_Mm01_00041398 predicted 1035
7 SASI_Mm01_00041399 predicted 868
8 SASI_Mm01_00041401 predicted 719
9 SASI_Mm01_00041402 predicted 733
10 SASI_Mm01_00041403 predicted 1576
11 SASI_Mm01_00041400 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172455
TMPRSS7 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-940s1c1
Sequence:CCGGGCCCTGAAATTCTACAACTATCTCGAGATAGTTGTAGAATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-573s1c1
Sequence:CCGGCTCCATTGAATCCATCCAATTCTCGAGAATTGGATGGATTCAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-1125s1c1
Sequence:CCGGCTTGGTAGAATATGGCGGTTACTCGAGTAACCGCCATATTCTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-1828s1c1
Sequence:CCGGGAAACCCTGAAACAGCTCATTCTCGAGAATGAGCTGTTTCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-871s1c1
Sequence:CCGGCCAAGTTACTATCCTCCGAAACTCGAGTTTCGGAGGATAGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172455
TMPRSS7 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-940s1c1
Sequence:CCGGGCCCTGAAATTCTACAACTATCTCGAGATAGTTGTAGAATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-573s1c1
Sequence:CCGGCTCCATTGAATCCATCCAATTCTCGAGAATTGGATGGATTCAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-1125s1c1
Sequence:CCGGCTTGGTAGAATATGGCGGTTACTCGAGTAACCGCCATATTCTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-1828s1c1
Sequence:CCGGGAAACCCTGAAACAGCTCATTCTCGAGAATGAGCTGTTTCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-871s1c1
Sequence:CCGGCCAAGTTACTATCCTCCGAAACTCGAGTTTCGGAGGATAGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172455
TMPRSS7 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-940s1c1
Sequence:CCGGGCCCTGAAATTCTACAACTATCTCGAGATAGTTGTAGAATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-573s1c1
Sequence:CCGGCTCCATTGAATCCATCCAATTCTCGAGAATTGGATGGATTCAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-1125s1c1
Sequence:CCGGCTTGGTAGAATATGGCGGTTACTCGAGTAACCGCCATATTCTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-1828s1c1
Sequence:CCGGGAAACCCTGAAACAGCTCATTCTCGAGAATGAGCTGTTTCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172455.1-871s1c1
Sequence:CCGGCCAAGTTACTATCCTCCGAAACTCGAGTTTCGGAGGATAGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042575
TMPRSS7 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1407s21c1
Sequence:CCGGAGCGTTGTGATGGAGTAAATGCTCGAGCATTTACTCCATCACAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1371s21c1
Sequence:CCGGTTAGATGCTCCTCCGGTTTATCTCGAGATAAACCGGAGGAGCATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-955s21c1
Sequence:CCGGCTCAGGAATCCGGGCATATTTCTCGAGAAATATGCCCGGATTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-2222s21c1
Sequence:CCGGATGCTCTGTGCAGGCATAATGCTCGAGCATTATGCCTGCACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1944s21c1
Sequence:CCGGTTGTGGTCCACGAGTACTATACTCGAGTATAGTACTCGTGGACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042575
TMPRSS7 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1407s21c1
Sequence:CCGGAGCGTTGTGATGGAGTAAATGCTCGAGCATTTACTCCATCACAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1371s21c1
Sequence:CCGGTTAGATGCTCCTCCGGTTTATCTCGAGATAAACCGGAGGAGCATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-955s21c1
Sequence:CCGGCTCAGGAATCCGGGCATATTTCTCGAGAAATATGCCCGGATTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-2222s21c1
Sequence:CCGGATGCTCTGTGCAGGCATAATGCTCGAGCATTATGCCTGCACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1944s21c1
Sequence:CCGGTTGTGGTCCACGAGTACTATACTCGAGTATAGTACTCGTGGACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042575
TMPRSS7 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1407s21c1
Sequence:CCGGAGCGTTGTGATGGAGTAAATGCTCGAGCATTTACTCCATCACAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1371s21c1
Sequence:CCGGTTAGATGCTCCTCCGGTTTATCTCGAGATAAACCGGAGGAGCATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-955s21c1
Sequence:CCGGCTCAGGAATCCGGGCATATTTCTCGAGAAATATGCCCGGATTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-2222s21c1
Sequence:CCGGATGCTCTGTGCAGGCATAATGCTCGAGCATTATGCCTGCACAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042575.1-1944s21c1
Sequence:CCGGTTGTGGTCCACGAGTACTATACTCGAGTATAGTACTCGTGGACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks