EMAIL THIS PAGE TO A FRIEND

TMPRSS9

transmembrane protease, serine 9

UniProtKB ID: Q7Z410, Q6ZND6, Q7Z411
Gene ID:
Mouse(432478) transmembrane protease, serine 9
Rat(314636) transmembrane protease, serine 9
domestic guinea pig(100720183) transmembrane protease, serine 9
naked mole-rat(101707692) transmembrane protease, serine 9
cow(518647) transmembrane protease, serine 9
sheep(101120493) transmembrane protease, serine 9
Zebrafish(562051) transmembrane protease, serine 9
Horse(100146332) transmembrane protease, serine 9
domestic cat(101081523) transmembrane protease, serine 9
dog(612163) transmembrane protease, serine 9
chicken(428320) transmembrane protease, serine 9
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182973 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182973 Rosetta Predictions human pricing
NM_001047100 Rosetta Predictions rat pricing
NM_001081688 Rosetta Predictions mouse pricing
XM_982870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121508 predicted 487
2 SASI_Hs01_00121509 predicted 750
3 SASI_Hs01_00121510 predicted 370
4 SASI_Hs02_00371131 predicted 2184
5 SASI_Hs01_00121511 predicted 1265
6 SASI_Hs01_00121512 predicted 2262
7 SASI_Hs01_00121513 predicted 1998
8 SASI_Hs01_00121514 predicted 2937
9 SASI_Hs01_00121515 predicted 1070
10 SASI_Hs01_00121516 predicted 2426
11 SASI_Hs01_00121507 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205934 predicted 2701
2 SASI_Rn02_00205935 predicted 1806
3 SASI_Rn02_00205936 predicted 658
4 SASI_Rn02_00205937 predicted 1285
5 SASI_Rn02_00205938 predicted 2145
6 SASI_Rn02_00205939 predicted 1897
7 SASI_Rn02_00205940 predicted 444
8 SASI_Rn02_00205941 predicted 1985
9 SASI_Rn02_00205942 predicted 347
10 SASI_Rn02_00205943 predicted 2728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299021 predicted 2262
2 SASI_Mm02_00299022 predicted 2002
3 SASI_Mm02_00299023 predicted 2275
4 SASI_Mm02_00299024 predicted 2460
5 SASI_Mm02_00299025 predicted 2400
6 SASI_Mm02_00299026 predicted 423
7 SASI_Mm02_00299027 predicted 349
8 SASI_Mm02_00299028 predicted 2241
9 SASI_Mm02_00299029 predicted 570
10 SASI_Mm02_00299030 predicted 3083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266594 predicted 2829
2 SASI_Mm01_00266595 predicted 2281
3 SASI_Mm01_00266596 predicted 2020
4 SASI_Mm01_00266597 predicted 2472
5 SASI_Mm01_00266598 predicted 538
6 SASI_Mm01_00266599 predicted 2261
7 SASI_Mm01_00266600 predicted 586
8 SASI_Mm01_00266601 predicted 962
9 SASI_Mm01_00266602 predicted 1404
10 SASI_Mm01_00266603 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081688
TMPRSS9 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-2388s21c1
Sequence:CCGGCACAGCTGCTGGCCTCATTATCTCGAGATAATGAGGCCAGCAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-202s21c1
Sequence:CCGGATCCGTTTCACCAGTTCTTTGCTCGAGCAAAGAACTGGTGAAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-271s21c1
Sequence:CCGGACACTGTTTGTGAGTAGTTTCCTCGAGGAAACTACTCACAAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-2251s21c1
Sequence:CCGGGCTAAGAAGCCTGGCGTATATCTCGAGATATACGCCAGGCTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081688
TMPRSS9 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-2388s21c1
Sequence:CCGGCACAGCTGCTGGCCTCATTATCTCGAGATAATGAGGCCAGCAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-202s21c1
Sequence:CCGGATCCGTTTCACCAGTTCTTTGCTCGAGCAAAGAACTGGTGAAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-271s21c1
Sequence:CCGGACACTGTTTGTGAGTAGTTTCCTCGAGGAAACTACTCACAAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-2251s21c1
Sequence:CCGGGCTAAGAAGCCTGGCGTATATCTCGAGATATACGCCAGGCTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081688
TMPRSS9 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-2388s21c1
Sequence:CCGGCACAGCTGCTGGCCTCATTATCTCGAGATAATGAGGCCAGCAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-202s21c1
Sequence:CCGGATCCGTTTCACCAGTTCTTTGCTCGAGCAAAGAACTGGTGAAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-271s21c1
Sequence:CCGGACACTGTTTGTGAGTAGTTTCCTCGAGGAAACTACTCACAAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081688.2-2251s21c1
Sequence:CCGGGCTAAGAAGCCTGGCGTATATCTCGAGATATACGCCAGGCTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182973
TMPRSS9 MISSION shRNA Bacterial Glycerol Stock
transmembrane protease, serine 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1803s1c1
Sequence:CCGGCCTGGCCTTCAACAAATACATCTCGAGATGTATTTGTTGAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-2709s1c1
Sequence:CCGGGCACCCGTTCTACAATCTCTACTCGAGTAGAGATTGTAGAACGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-727s1c1
Sequence:CCGGCACTGCTTCAATGAGTTCCAACTCGAGTTGGAACTCATTGAAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1453s1c1
Sequence:CCGGACCGTTCCTAAGCTACAAGAACTCGAGTTCTTGTAGCTTAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1454s1c1
Sequence:CCGGCCGTTCCTAAGCTACAAGAATCTCGAGATTCTTGTAGCTTAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182973
TMPRSS9 MISSION shRNA shRNA Plasmid DNA
transmembrane protease, serine 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1803s1c1
Sequence:CCGGCCTGGCCTTCAACAAATACATCTCGAGATGTATTTGTTGAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-2709s1c1
Sequence:CCGGGCACCCGTTCTACAATCTCTACTCGAGTAGAGATTGTAGAACGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-727s1c1
Sequence:CCGGCACTGCTTCAATGAGTTCCAACTCGAGTTGGAACTCATTGAAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1453s1c1
Sequence:CCGGACCGTTCCTAAGCTACAAGAACTCGAGTTCTTGTAGCTTAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1454s1c1
Sequence:CCGGCCGTTCCTAAGCTACAAGAATCTCGAGATTCTTGTAGCTTAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182973
TMPRSS9 MISSION shRNA Lentiviral Transduction Particles
transmembrane protease, serine 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1803s1c1
Sequence:CCGGCCTGGCCTTCAACAAATACATCTCGAGATGTATTTGTTGAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-2709s1c1
Sequence:CCGGGCACCCGTTCTACAATCTCTACTCGAGTAGAGATTGTAGAACGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-727s1c1
Sequence:CCGGCACTGCTTCAATGAGTTCCAACTCGAGTTGGAACTCATTGAAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1453s1c1
Sequence:CCGGACCGTTCCTAAGCTACAAGAACTCGAGTTCTTGTAGCTTAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182973.1-1454s1c1
Sequence:CCGGCCGTTCCTAAGCTACAAGAATCTCGAGATTCTTGTAGCTTAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks