EMAIL THIS PAGE TO A FRIEND

TMSB10

thymosin beta 10

Synonyms: MIG12 TB10
UniProtKB ID: P63313, P13472, Q596K9
Gene ID:
Mouse(19240) thymosin, beta 10
Rat(50665) thymosin, beta 10
chicken(770993) thymosin, beta 10
Horse(100033928) thymosin beta 10
cow(282385) thymosin beta 10
sheep(101122849) thymosin beta 10
naked mole-rat(101710411) thymosin beta 10
Gene Class: Cytoskeleton
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056251 MISSION® esiRNA esiRNA human TMSB10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021103 Rosetta Predictions human pricing
NM_021261 Rosetta Predictions rat pricing
NM_001039392 Rosetta Predictions mouse pricing
NM_025284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354590 predicted 268
2 SASI_Hs01_00026644 predicted 210
3 SASI_Hs02_00354591 predicted 120
4 SASI_Hs01_00026646 predicted 212
5 SASI_Hs01_00026647 predicted 267
6 SASI_Hs01_00026649 predicted 126
7 SASI_Hs01_00026650 predicted 170
8 SASI_Hs01_00026652 predicted 210
9 SASI_Hs01_00026653 predicted 179
10 SASI_Hs02_00354592 predicted 181
11 SASI_Hs01_00026645 predicted 230
12 SASI_Hs01_00026648 predicted 123
13 SASI_Hs01_00026651 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100379 predicted 293
2 SASI_Rn01_00100380 predicted 402
3 SASI_Rn02_00262564 predicted 368
4 SASI_Rn02_00262565 predicted 398
5 SASI_Rn02_00262566 predicted 405
6 SASI_Rn02_00262567 predicted 342
7 SASI_Rn02_00262568 predicted 338
8 SASI_Rn02_00262569 predicted 314
9 SASI_Rn02_00262570 predicted 293
10 SASI_Rn01_00100375 predicted 151
11 SASI_Rn01_00100371 predicted 260
12 SASI_Rn01_00100372 predicted 232
13 SASI_Rn01_00100373 predicted 222
14 SASI_Rn01_00100374 predicted 268
15 SASI_Rn01_00100376 predicted 234
16 SASI_Rn01_00100377 predicted 238
17 SASI_Rn01_00100378 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290051 predicted 250
2 SASI_Mm01_00104161 predicted 551
3 SASI_Mm02_00290052 predicted 311
4 SASI_Mm02_00290053 predicted 244
5 SASI_Mm01_00104164 predicted 547
6 SASI_Mm02_00290054 predicted 257
7 SASI_Mm01_00104166 predicted 472
8 SASI_Mm01_00104168 predicted 472
9 SASI_Mm02_00290055 predicted 308
10 SASI_Mm02_00290056 predicted 432
11 SASI_Mm01_00104159 predicted 458
12 SASI_Mm01_00104160 predicted 530
13 SASI_Mm01_00104162 predicted 506
14 SASI_Mm01_00104163 predicted 534
15 SASI_Mm01_00104165 predicted 502
16 SASI_Mm01_00104167 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327895 predicted 100
2 SASI_Mm01_00030122 predicted 408
3 SASI_Mm02_00327896 predicted 162
4 SASI_Mm02_00327897 predicted 94
5 SASI_Mm01_00030125 predicted 405
6 SASI_Mm02_00327898 predicted 106
7 SASI_Mm01_00030127 predicted 331
8 SASI_Mm01_00030129 predicted 327
9 SASI_Mm02_00327899 predicted 159
10 SASI_Mm02_00327900 predicted 287
11 SASI_Mm01_00030120 predicted 306
12 SASI_Mm01_00030121 predicted 387
13 SASI_Mm01_00030123 predicted 353
14 SASI_Mm01_00030124 predicted 385
15 SASI_Mm01_00030126 predicted 357
16 SASI_Mm01_00030128 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021103
VALIDATED
TMSB10 MISSION shRNA Bacterial Glycerol Stock
thymosin beta 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-269s1c1
Sequence:CCGGCCCAGTCGTGATGTGGAGGAACTCGAGTTCCTCCACATCACGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-180s1c1
Sequence:CCGGCTGCCGACCAAAGAGACCATTCTCGAGAATGGTCTCTTTGGTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-204s1c1
Sequence:CCGGCAGGAGAAGCGGAGTGAAATTCTCGAGAATTTCACTCCGCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-182s1c1
Sequence:CCGGGCCGACCAAAGAGACCATTGACTCGAGTCAATGGTCTCTTTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021103.3-209s1c1
Sequence:CCGGGAAGCGGAGTGAAATTTCCTACTCGAGTAGGAAATTTCACTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021103.3-313s21c1
Sequence:CCGGAGCCACAAGCTGCACTGTGAACTCGAGTTCACAGTGCAGCTTGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-119s21c1
Sequence:CCGGGGAAATCGCCAGCTTCGATAACTCGAGTTATCGAAGCTGGCGATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-169s21c1
Sequence:CCGGAGAAGAACACCCTGCCGACCACTCGAGTGGTCGGCAGGGTGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-193s21c1
Sequence:CCGGAGACCATTGAGCAGGAGAAGCCTCGAGGCTTCTCCTGCTCAATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021103
VALIDATED
TMSB10 MISSION shRNA shRNA Plasmid DNA
thymosin beta 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-269s1c1
Sequence:CCGGCCCAGTCGTGATGTGGAGGAACTCGAGTTCCTCCACATCACGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-180s1c1
Sequence:CCGGCTGCCGACCAAAGAGACCATTCTCGAGAATGGTCTCTTTGGTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-204s1c1
Sequence:CCGGCAGGAGAAGCGGAGTGAAATTCTCGAGAATTTCACTCCGCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-182s1c1
Sequence:CCGGGCCGACCAAAGAGACCATTGACTCGAGTCAATGGTCTCTTTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021103.3-209s1c1
Sequence:CCGGGAAGCGGAGTGAAATTTCCTACTCGAGTAGGAAATTTCACTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021103.3-313s21c1
Sequence:CCGGAGCCACAAGCTGCACTGTGAACTCGAGTTCACAGTGCAGCTTGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-119s21c1
Sequence:CCGGGGAAATCGCCAGCTTCGATAACTCGAGTTATCGAAGCTGGCGATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-169s21c1
Sequence:CCGGAGAAGAACACCCTGCCGACCACTCGAGTGGTCGGCAGGGTGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-193s21c1
Sequence:CCGGAGACCATTGAGCAGGAGAAGCCTCGAGGCTTCTCCTGCTCAATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021103
VALIDATED
TMSB10 MISSION shRNA Lentiviral Transduction Particles
thymosin beta 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-269s1c1
Sequence:CCGGCCCAGTCGTGATGTGGAGGAACTCGAGTTCCTCCACATCACGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-180s1c1
Sequence:CCGGCTGCCGACCAAAGAGACCATTCTCGAGAATGGTCTCTTTGGTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-204s1c1
Sequence:CCGGCAGGAGAAGCGGAGTGAAATTCTCGAGAATTTCACTCCGCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021103.3-182s1c1
Sequence:CCGGGCCGACCAAAGAGACCATTGACTCGAGTCAATGGTCTCTTTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021103.3-209s1c1
Sequence:CCGGGAAGCGGAGTGAAATTTCCTACTCGAGTAGGAAATTTCACTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021103.3-313s21c1
Sequence:CCGGAGCCACAAGCTGCACTGTGAACTCGAGTTCACAGTGCAGCTTGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-119s21c1
Sequence:CCGGGGAAATCGCCAGCTTCGATAACTCGAGTTATCGAAGCTGGCGATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-169s21c1
Sequence:CCGGAGAAGAACACCCTGCCGACCACTCGAGTGGTCGGCAGGGTGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021103.3-193s21c1
Sequence:CCGGAGACCATTGAGCAGGAGAAGCCTCGAGGCTTCTCCTGCTCAATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025284
VALIDATED
TMSB10 MISSION shRNA Bacterial Glycerol Stock
thymosin beta 10
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-160s1c1
Sequence:CCGGCCTGCCGACCAAAGAGACCATCTCGAGATGGTCTCTTTGGTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025284.2-106s1c1
Sequence:CCGGCGCCAGCTTCGATAAGGCCAACTCGAGTTGGCCTTATCGAAGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-112s1c1
Sequence:CCGGCTTCGATAAGGCCAAGCTGAACTCGAGTTCAGCTTGGCCTTATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-116s1c1
Sequence:CCGGGATAAGGCCAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGGCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025284
VALIDATED
TMSB10 MISSION shRNA shRNA Plasmid DNA
thymosin beta 10
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-160s1c1
Sequence:CCGGCCTGCCGACCAAAGAGACCATCTCGAGATGGTCTCTTTGGTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025284.2-106s1c1
Sequence:CCGGCGCCAGCTTCGATAAGGCCAACTCGAGTTGGCCTTATCGAAGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-112s1c1
Sequence:CCGGCTTCGATAAGGCCAAGCTGAACTCGAGTTCAGCTTGGCCTTATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-116s1c1
Sequence:CCGGGATAAGGCCAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGGCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025284
VALIDATED
TMSB10 MISSION shRNA Lentiviral Transduction Particles
thymosin beta 10
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-160s1c1
Sequence:CCGGCCTGCCGACCAAAGAGACCATCTCGAGATGGTCTCTTTGGTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025284.2-106s1c1
Sequence:CCGGCGCCAGCTTCGATAAGGCCAACTCGAGTTGGCCTTATCGAAGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-112s1c1
Sequence:CCGGCTTCGATAAGGCCAAGCTGAACTCGAGTTCAGCTTGGCCTTATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025284.2-116s1c1
Sequence:CCGGGATAAGGCCAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGGCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks