EMAIL THIS PAGE TO A FRIEND

TMSB15A

thymosin beta 15a

Synonyms: TMSB15 TMSB15B TMSL8 TMSNB Tb15 TbNB
UniProtKB ID: P0CG34, A8K614, Q99406
Gene ID:
Mouse(78478) thymosin beta 15a
Gene Class: Cytoskeleton
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021992 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129531 MISSION® esiRNA esiRNA human TMSB15A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021992 Rosetta Predictions human pricing
NM_030106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193095 predicted 331
2 SASI_Hs01_00193096 predicted 357
3 SASI_Hs02_00355359 predicted 439
4 SASI_Hs01_00193099 predicted 271
5 SASI_Hs01_00193101 predicted 396
6 SASI_Hs01_00193102 predicted 370
7 SASI_Hs01_00193103 predicted 326
8 SASI_Hs01_00193104 predicted 372
9 SASI_Hs02_00355360 predicted 292
10 SASI_Hs02_00355361 predicted 352
11 SASI_Hs01_00193097 predicted 239
12 SASI_Hs01_00193098 predicted 239
13 SASI_Hs01_00193100 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107811 predicted 139
2 SASI_Mm01_00107812 predicted 215
3 SASI_Mm01_00107814 predicted 128
4 SASI_Mm01_00107815 predicted 144
5 SASI_Mm01_00107816 predicted 130
6 SASI_Mm01_00107817 predicted 134
7 SASI_Mm01_00107818 predicted 204
8 SASI_Mm01_00107819 predicted 185
9 SASI_Mm01_00107820 predicted 140
10 SASI_Mm02_00336493 predicted 146
11 SASI_Mm01_00107813 predicted 130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021992
VALIDATED
TMSB15A MISSION shRNA Bacterial Glycerol Stock
thymosin beta 15a
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-367s21c1
Sequence:CCGGGGATATCTTCTCACCTATGTTCTCGAGAACATAGGTGAGAAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-485s21c1
Sequence:CCGGTCTCACCATTGATGACCTTTGCTCGAGCAAAGGTCATCAATGGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-436s21c1
Sequence:CCGGTAAACTTACCATTGGTGCATACTCGAGTATGCACCAATGGTAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-252s1c1
Sequence:CCGGCAACAGCAGATTTCGACATTACTCGAGTAATGTCGAAATCTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021992.1-379s1c1
Sequence:CCGGGAGGTAGCCAATGTTTCCTTACTCGAGTAAGGAAACATTGGCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-185s1c1
Sequence:CCGGCCCTCAAAGGAAACTATCCAGCTCGAGCTGGATAGTTTCCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-202s1c1
Sequence:CCGGCCAGCAAGAGAAAGAGTGTGTCTCGAGACACACTCTTTCTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-198s1c1
Sequence:CCGGCTATCCAGCAAGAGAAAGAGTCTCGAGACTCTTTCTCTTGCTGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-189s1c1
Sequence:CCGGCAAAGGAAACTATCCAGCAAGCTCGAGCTTGCTGGATAGTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-205s1c1
Sequence:CCGGGCAAGAGAAAGAGTGTGTTCACTCGAGTGAACACACTCTTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-209s1c1
Sequence:CCGGGAGAAAGAGTGTGTTCAAACACTCGAGTGTTTGAACACACTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021992.1-206s1c1
Sequence:CCGGCAAGAGAAAGAGTGTGTTCAACTCGAGTTGAACACACTCTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-211s1c1
Sequence:CCGGGAAAGAGTGTGTTCAAACATCCTCGAGGATGTTTGAACACACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-194s1c1
Sequence:CCGGGAAACTATCCAGCAAGAGAAACTCGAGTTTCTCTTGCTGGATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-448s1c1
Sequence:CCGGGCTGTCAATAATCTCACCATTCTCGAGAATGGTGAGATTATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021992
VALIDATED
TMSB15A MISSION shRNA shRNA Plasmid DNA
thymosin beta 15a
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-367s21c1
Sequence:CCGGGGATATCTTCTCACCTATGTTCTCGAGAACATAGGTGAGAAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-485s21c1
Sequence:CCGGTCTCACCATTGATGACCTTTGCTCGAGCAAAGGTCATCAATGGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-436s21c1
Sequence:CCGGTAAACTTACCATTGGTGCATACTCGAGTATGCACCAATGGTAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-252s1c1
Sequence:CCGGCAACAGCAGATTTCGACATTACTCGAGTAATGTCGAAATCTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021992.1-379s1c1
Sequence:CCGGGAGGTAGCCAATGTTTCCTTACTCGAGTAAGGAAACATTGGCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-185s1c1
Sequence:CCGGCCCTCAAAGGAAACTATCCAGCTCGAGCTGGATAGTTTCCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-202s1c1
Sequence:CCGGCCAGCAAGAGAAAGAGTGTGTCTCGAGACACACTCTTTCTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-198s1c1
Sequence:CCGGCTATCCAGCAAGAGAAAGAGTCTCGAGACTCTTTCTCTTGCTGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-189s1c1
Sequence:CCGGCAAAGGAAACTATCCAGCAAGCTCGAGCTTGCTGGATAGTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-205s1c1
Sequence:CCGGGCAAGAGAAAGAGTGTGTTCACTCGAGTGAACACACTCTTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-209s1c1
Sequence:CCGGGAGAAAGAGTGTGTTCAAACACTCGAGTGTTTGAACACACTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021992.1-206s1c1
Sequence:CCGGCAAGAGAAAGAGTGTGTTCAACTCGAGTTGAACACACTCTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-211s1c1
Sequence:CCGGGAAAGAGTGTGTTCAAACATCCTCGAGGATGTTTGAACACACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-194s1c1
Sequence:CCGGGAAACTATCCAGCAAGAGAAACTCGAGTTTCTCTTGCTGGATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-448s1c1
Sequence:CCGGGCTGTCAATAATCTCACCATTCTCGAGAATGGTGAGATTATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021992
VALIDATED
TMSB15A MISSION shRNA Lentiviral Transduction Particles
thymosin beta 15a
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-367s21c1
Sequence:CCGGGGATATCTTCTCACCTATGTTCTCGAGAACATAGGTGAGAAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-485s21c1
Sequence:CCGGTCTCACCATTGATGACCTTTGCTCGAGCAAAGGTCATCAATGGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021992.2-436s21c1
Sequence:CCGGTAAACTTACCATTGGTGCATACTCGAGTATGCACCAATGGTAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-252s1c1
Sequence:CCGGCAACAGCAGATTTCGACATTACTCGAGTAATGTCGAAATCTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021992.1-379s1c1
Sequence:CCGGGAGGTAGCCAATGTTTCCTTACTCGAGTAAGGAAACATTGGCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-185s1c1
Sequence:CCGGCCCTCAAAGGAAACTATCCAGCTCGAGCTGGATAGTTTCCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-202s1c1
Sequence:CCGGCCAGCAAGAGAAAGAGTGTGTCTCGAGACACACTCTTTCTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-198s1c1
Sequence:CCGGCTATCCAGCAAGAGAAAGAGTCTCGAGACTCTTTCTCTTGCTGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-189s1c1
Sequence:CCGGCAAAGGAAACTATCCAGCAAGCTCGAGCTTGCTGGATAGTTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-205s1c1
Sequence:CCGGGCAAGAGAAAGAGTGTGTTCACTCGAGTGAACACACTCTTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-209s1c1
Sequence:CCGGGAGAAAGAGTGTGTTCAAACACTCGAGTGTTTGAACACACTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021992.1-206s1c1
Sequence:CCGGCAAGAGAAAGAGTGTGTTCAACTCGAGTTGAACACACTCTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021992.1-211s1c1
Sequence:CCGGGAAAGAGTGTGTTCAAACATCCTCGAGGATGTTTGAACACACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-194s1c1
Sequence:CCGGGAAACTATCCAGCAAGAGAAACTCGAGTTTCTCTTGCTGGATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021992.1-448s1c1
Sequence:CCGGGCTGTCAATAATCTCACCATTCTCGAGAATGGTGAGATTATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks